pescidillo

cDNA: Genbank U77627

 

hi2 is in the 5 UTR

 

tcatgaatttctacgcaggcattcgctcgggtgagcaaaatcccagggtc

ctactctctcggctctctggcgtcacacaaaacacgtgtgttCTGGAGAC

GCACGTTAGCGC

hi2 (3-5)

TGAAGTATATTTGCTGTGTTTATTTACAGTGGTTTTTATATTAAGTTTTG

CCGAGTGACAAAACGCAGATACCGCTGCC

ATGGGCGGATTACAAAAGAAGAAGgtaagaccgagattcagaacaaaact

attgtaaacaaaacgtgatatcttgttgagcgcatgggcccttttgcagg

cttctgaacacagtcggtattgtagtgtttacttatagccaaatggcata

cgatatgtttaattggtttattttgacgtggacccttaactgtaatgtct

agtttcagttaattgcagctttgactgacaggtatcatgagtaaaacata

tctgtgtgaaaaaaatgtgtcgtgcatttacagcatgctctatcgttatg

tgttaacttgacgtttcttcttgtttagTATGAGAGTGGGTCAGCCACTA

ACTACATCACCAGGAATAAAGCTCGTAAGAAGCTGAGTCTGAGTCTGGCT

GATTTCAGgttggtttacacatctgtcacactcgcttctagggcttcacg

atgttggaaaactctgacattgcgatgtttttttttcctgctgtaaatat

gttgacatgaatacagtttcccaagagggtttgaatagctctatttgctg

gttttctggtgagcctaccagtattcagctgcagaaattgaataatcaca

atgcaagaaagcatgtatttcatgctttgtctcgtttttgtgcaaatttc

ttgtagatcaagtaaaacttataggtgggcatagataatttttttatcta

gaataatctcagaattaaaacttgtcggcagaattcaaatgagccattca

gaatatgtgtgctacctaaataagtctttaagaacaggtttctcaagcca

ggtggcgcttaagaccaggggctcatctcctgtttccaaaatgcatcaca

aactgcttgaaaaactgttctacaatgataattggtgataaaattaaaag

attttcaataagatgcatttgtgtttactgtttgttcagttaaacatgaa

ttttgaactgtaggcctacataagctcaaaacagaaatcatggtgaaaat

gtatgtcaatcataattgtttcgcataatttttacaccgcagatgtatta

taactcttactttgtgttttatgtttgtgcatgtaattaaacttgtgtat

taatgtatgcatctgatgttgtagGCGGTTATGCATATTAAAAGGAATTT

ATCCTCATGAGCCCAAACACAAAAAGAAGGTCAACAAGGGCTCGACGGCT

GCTAGAACTTACTATCTGCTGAAAGACATCCGCTTCCTGCTGCATGAACC

CATCGTTGGCAAATTCAGAGAGTATAAGgtggggctgtgccttcggtaaa

gctgcatgctggtctttgcccctaattagtttgatcaattttgtacattt

gggtttttgagttaaatgacagtagagctaatatactggttggttggtaa

ttcccttctaaaagtaactagaaagatgcaccaatttaggtctgaagtcc

ttgctgttttatttaactatttatttatttgtttttttttttgctttatt

ttataactcttatctgttttccttcaatatcttggcttatatttaaagct

gatttcatatggtatctaattccactttggtcgtacaattagtaaataat

atagttgaactataatgtctctgattatagggtggtaatgattctgataa

tgactgaattgtctactagtctaactatgacactcaaacatatttttgtt

tttaattaattagcatttcacagctgatggcattgtcactataatttttg

ctacacataaaatgtaaaatgagaaattttactttattattagaaatatt

ttggctatttgcatgctgttttatctaaaaatacgtgttgttcctatgct

gaatttagtagtttgttcttggatgtatacggtgcatgccatggtatcac

tactcttttccagtccttatgtgtaatctcacaacatttataccgttgta

ttgatcaaataaattatgcataaaatccagattataaaatatcggcttga

ttttggcatgatctgtttgaatgcattgtgtttcggttattgatgttgat

aagattatgtaggtctttaaagatagcaagttatgattggtctggaaaaa

gttgtgcttggacatgtgctgtccatgactcaacaagaataattttttat

ttgacaagaatttatggacttgtctgactttctgactatcataatagtag

ggctgtgcaattaatcaaaaatccggtttcgatttggcatctaacgatta

tgaaaaaccatctatcaatattccatcatataccgtcccctttccagttg

tacacatttgttgctctgcaaagctcagttccacatgaaaatgactaaaa

agcatgtgctgtaatgtaacgtttgcagcatgggatacgcatcattcatt

aatgtatgttcgaatcattaatgttttttaaaagcttgaaaaagcgcatg

gtgtgtgtgcgtgtgtgccgcacttagccttaaagctaaagatgtttaaa

gcagtttaaacataacagatttaataactcatttcttttatctttgctat

gatgacagtacattatattttactagatatttttcaagatattttttgtg

atatattttcacatcctgaaatctttcttccctgattatagatct