baculoviral IAP repeat-containing 2

cDNA: Genbank AF442500 (5 UTR from ests such as CN833200)

 

hi2026a is in the 1st intron, before the ATG

 

gccgtcaaaaaaaaacatgcgggcgttttcatgacattttcttaaaaaga

acaattaaatatacattttcctcattttagtgttcattttaatcctattt

attctcgggtcaatactaaaaatatctgtagacctgtcccatacattaat

tccagctgttattaccacatttttttttatcaacaattgatattttcttg

ttatattacttgaacaacatgtaatgtgttatatgtaaaagcgtgtcact

gagccttttagttaCGTCATTTCCGCCGAATTGGACCGAACAGAAGAAAG

GACATTTTGTGCTGTTGAACAAAAATCGTTTTTGTTCTTAGCATAGgtga

gtttgtcgttttgtaaccattctgctgccagaacgcatgagctaattgcc

gttgcgggattgtaggtcttacattttggcgtataaacagaataaatcgc

catctgatgcaacaccagccaaaagtcctctgtagaaaatggcagcgtcg

gttgtcagggctcaaaatagaatgttttaccagtgtgcccactcatgggt

cagaaatcgtcgtctgcgtgcaggtggaatgattcacgtcgatggggctt

tccccgttattttggatttggtaaagtcgccaaatactgaaacttagggt

ggaaacttatgaccgtcatttgagtgatcgtcatcattttgcggaaatgc

ttcacacaataaaaaatacgggaaaaatatgaagaaaaaaaaacctttta

atacctttgttttgctccaaaaataatctgagtgttttgaatgttgttga

gcttccaggatttaaataatgacttgtaagaacatctgcgtgcacttaat

tcgttaaaggaatgaggaagtgagacctaaaacggcaaaaaacaccgaaa

agtgataactgttaagtttaaacagtaactttgtgactagggagcaacta

ggggtggattttaaacctgaacccatatttcagttacatacagttttata

ttaaaaagcatccatggcaagttattaaaatcaacacaatgtcat

hi2026a (3-5)

gtgtacatttcgttatttagtttgatactaaaagccaacctaaatgagtt

caataaatctcagaatcagtaaagtccaaattaaaataaaaatataattg

taattaattgtaaatcataatttatattcacaaggacttttaattttagc

caggcaccccaagggcttcaggtgaacagtatttccattaaaaatggtca

agtttaagatctgtcactcattcattcattcattttcttattggcttagt

ccctttattaatccggggtcgccacagcggaatgaaccgccaacttatcc

agcaagttttttacgcagcggatacccttccagctgcaacccatctctgg

gaaacatccacacacacattcacacacacactcatacactacggacaatt

tagcttacccaattcacctgtaccgcatgtctttcgactggcggaaaccg

gagcacccggaggaaacccacacgaatgcagggagaacatgcaaattcca

cacagaaacgccaactgagccgaggttcgatccagcgaccttcttgctgt

gaggcgacagcactacctactgcgccactgcctcgcccgtttaagatctg

ttttctttaaaaatccatgtcttacaaaatagaattttgatgtaaataaa

aattaactgtgtcttcaaaataggcaacgcagtggcgcagttggcagtgt

tgttggttcgaacctcggctcagttggcatttctgtgtagagtttgcatg

ttcccccgcgtgggtttcctccgggtgctctggtttctcccacagtccaa

agacatggggtacaggtgaattgggttggctaaattgtctgtagtgtatg

agtgtatggatgtttcccagagatgggttgcggctggaagggcatccgct

gcgtaaaaacgtgctggataagttggcggttcattttgctgtggcgaccc

gtgattaataaagggactaagccgacaagaaaattaatggatgaatgaat

gtcttcaacatatgacagtctattttaccccagcattaccccacggcgct

agtggtcacaatggcctttcatcttgttttacgcttgaacaactaaatga

atgctgtctgtttacctaaatgtattgttatagcactacaacattgatac

cgtaaaaacaaccttgggaattaaaaatagtcacattaagctttcaccgg

aagtttattgttggctttaaaactctagctgtgcatagagctcattagac

ctgtgtatttaacaaaactctctttgttatttccagATTCCTGCATCATA

GGGGAAGGAAGCACATACATCCCACATCAGCGTGCTATTTGTTTGAGATT

TAATTTAAGTTTTTTAATAAGGTCATGTATTCTACCATGGACGACTAGAC

CCCATTCAGGGGATGTCCAGCAGAGAGAAAGATTTGAATGAATACACCCT

GTGGTCACATTTTAGTGTTTGTATGTTAAATTTCTTACTAATATGTTACA

CTTCAAAGAAGGCACTCCTTCACTTTTAAAAATGTGTTTTGGTTTGTGTA

ATTGTGGTGTATTTCTCATTGATAAAGGTTGAGCTTCCACAGTCTCTAGG

ATGATCATCTAAACGTTAAGTTGTGCATCACATTATGTTCATGCAGTTTT

AGTTCAGGCCACATGTCACCGGTTCTGTGATGAAACCCAGTTGGGTAACC

CACTCTTTTGTAATCCAGGCGTGTTGTAAGGACATAAGGAGGAGTCTTTT

TTTTATAAGTGTTTTCAAAGATTGTGTAATCTAGTTTGTCTTACTCGCAT

AGTTCATCATTAACATCTACATGCGCACACACACACAGGGTATGACAATC

AAGCCTTTCTCTCTGCTGGCTATCCCCTTCCCCATTTCTCTTTCTCAAAT

GGAAATATTACAAAACAGTGCTTTCTTAAGAGGTTTGTGTCGTACCAGTG

GTCCTGCGGATTTACAGTATGATAACTCCTCTGAACTCTTTCGAATTTCA

ACATATGCCAAGTTCCCCACCACCGCAGCGGTGACTGAAAGAAGTCTTGC

ACGAGCTGGCTTTTATTACACTGGACTGGGTGATCGTGTCCAGTGTTTCC

GCTGCAATGTGACTGCTGACAACTGGCAGTCTGGTGACTGTCCCGCAGAG

CGCCACAAACAGCTATCCCCCAACTGCAGCTTCATCCAGAGCTTACCTGC

CACCGCAAACCTCCTGTCCTCCTCTCACTCTGCTTTTTCCCCACTTCGCA

ATGTAGCTGTCCTGCAGCTGTCCGCCCCTGCGACTGCAGCCCCGTCAACC

ACTGCCCCGTCAACTTCTGGACAAACAGAGGAGCAAGTGGGTTACCTGAA

CATGGGATTCACCAACCTGGCTCCCTCCAGTCCCATTTCATCTCGTGGAG

TGGAGGATATGTCCCACCAGCGACCGCCTGCTTGTCACAATCCTGGTATG

CGTCGGGAACAGGAACGCCTTGACACTTTTCAGAATTGGACTCTTGCTAC

AGTTACTCCAGCCGAGCTTGCCAAAGCTGGTTTGTACTACCTTGGCCAGG

GTGACAGGGTGGCGTGCTTTAGTTGTGGTGGCCAGCTTGGCAGTTGGGAA

CCAGGAGATCGAGCGGTATCTGAGCATCAGAGACATTACCCCAACTGCCG

ATTCGTACGAGGTGATCGTGCTGATAACATCCCTTTATCTGGTGGCGGAC

TTTCAAATGTTTCCAACTCGGCCATGCAACAGTGTGAAGAAAGGCTACTC

ACATTTGTAAACTGGCCTTCCAGAATACCTGTTCGACCAGATCAGTTGGC

TAAAGCTGGTTTTTATTATGTTGgtaagggcctcggacacatcaggttac

tctgaagtctaaagtttgttaatgctcatgagtgttcaattttgttttgg

tagGTCGTAATGATGACGTGAAGTGTTTTTGTTGTGATGGTGGACTTAGA

TGTTGGGAGTCTGGTGATGATCCATGGGTCGAACATGCCAAGTGGTTTCC

AAGgtaattaagtgaggctttgagtcatttgatcattttatatgatgaca

ttctgtgaacatgcatttattttttactagATGTGAATACCTGTTGCAAG

AAAAGGGCCAAGAGTTTGTTCACCAGATTCAAGCAAGATTTCCAAGACTG

TTTGAACAGgtatgttaaaaatagggatgcactgataagcatgataccga

ttgacagataccggtaactttgtagatttagaggctgatatattagctg