synembryn-like

cDNA: Genbank AY648760

 

hi2039a is in the 1st intron

 

ttattattcgatcttaatttttggcctccgtccaggtattattgtcatgt

cccgaagtgactcgtaaaacagtgacgtttgacgggtgaaagttaaggag

ataagagagaaCAGGAGGTGTGTAGTGAAACTCATACTCACTGTTGTTGT

GTGCAGAAGGACTGACAGTGTTTCTAAGTGGACGGCAAAAGCATCATTCA

GAGATGAGTTTGAGTGATATTCTGTCAGAGATCGACGGTGGAGATGACAA

GAAGGTTGAAAAACTTTTGCTGAAGTATAACACTGAGgtaaagaggctgc

tgttagcatatcttgtgttgtttaaatgcgagcgttagcagtggaggtgt

tagcgagttagccgttggctaatctcaatacacccggtgtatgtgtgtga

atctccaaaaacattaacggtg

hi2039a (5-3)

taggtgaaacaacgtgcttgtttttaaacgttaaatatccacttcatccg

tattagcgaggcacgaggtatttgccttgtgatcgtagaatagcatccta

aagcttagttagcctgcgatgatggtaacc

 

approx 2.5 kb to next exon