cell division cycle 37 homolog

cDNA: Genbank BC045994               

 

hi2026a is upstream of the gene

 

gaaaaaagaacaaatgaccgaacaaagaaacatcttattcatctagaaag

tccaaatagcagcattcacacaaaaaaaaaactgaggaaaaaacaaaaca

aattaatatatataaaaaataataaaatttaaataaataaaaagcaaaat

acaatgcactttaatacaaaggggttaatcatcaaaaaagcctttaacag

actacacagtttaagggctttttttaatgtctcatcagctttaaggaatt

gaagaagaccattaaatccttgtggaaaagcagaaaagtgtgtgtggggg

gtattaaaaaatccgcatttatgaatgaaatagtttgccagagtcacaat

attgttaaccaaaaattccagctcagaattctgacaaaaagataattttt

ttacagttttaaaatcaaaatcaggtattacatattttaatcttaaccaa

acagtaatgt

hi2062 (3-5)

catcccataacttttgaaaatttgcataaataaaacaaatgttcctacgg

aacaacactaaacacgcgcgacagcttcctctcgctGATGCAAATGGCGC

GCAGTGATGACGACAACCGGCCGGAAGTGAAGGAGAATTCCAGAAAGAGC

GGCGGCACAAACACACACTGAACTCCTGCGACAACAATCCGAATAATCAC

AGCAATAATACCGACACACACCGCATTACAGCGGAAACACAACCGAGCGA

CACACACCGCATTACAGCGGAAAACACAACCGAGCGACTCACGCCACAAC

CGACCATGACGACCATCGACTACAGTGTGTGGGATCATATCGAGGTGTCC

GACGATGAGGACGACACACACCCGAACATCGACACACCGAGTCTGTTCCG

CTGGAGACACCAGGCGCGGGTGGAGCGGATGGAGGCGTTCACACAGAAGG

GTGTGGAGCTGGAGAAGAGCCTGATGGAGAGCCGGAGGAGGCTGGCGGAG

GCGCAGCGGCGGGTGCAGGAGCTCAGCTCCTCCTCCTCCTCCACTGAGCT

GAGCCGTGCACAGGCCGAGGAGAAGCAGCTGAAGAAGGAGGAGCGCAGCC

TGCAGAGGAAGATGGAGGAGCACCGGGCgGAGGAGAAGAAGATGCCCTGG

AACGTGGACACACTCAGCAGAGAGGGCTTCAGCAAGagtgtggtgaacgt

gaagccggagcagaagcaggagacggaggaggagaaggagg