nucleolin

cDNA: Genbank AY648761

 

hi2078 is in the 1st intron

 

ggcgacgagtggaaattccaggcaacacattagcaacggcctagcaacca

atcagagcatgctagcaaccacctagcaacacattagcaacgagctagaa

catctatagcaaccacctaacacccccttagcaagcactcagaacacatc

aaccgtctagcaacatcttagtaaccacctagaacaccctagcaactgcc

tagaaacaccttagctaccgcctagcaaaaccttagcaaccactcagaac

acataagcaaccacctagcaacgtcttagaaaccacctggaacaccctaa

caacttcctagtaatgccttggcaaccactcagaagtcccaggcaacacc

ttagcaaccgcctagcaatgccttagcaactacttagcaacaccttacca

accactcagaacaccctaacaactggctagcaacaccttagcaaccaatc

agaacaaccaaacaactgagttgcaatgccttgccaactgcctagcaacc

actgagaacccctagcaacataccaaactatattggaaacatgctaatct

tttgataactgtttcaaacttaaaacacttcagttatttaaacttcacac

tttcagactcggctttctcaagagaccaaatttgtctacgaactttaaat

ttctagttcattcattcattcattcattcattcattcatactgttcaatg

agcgcaaaaaaaatcagaaaaaaactgttcaaaagaaccgaatggagata

acgagtctgaacagcagcgactcggttcacattgagcttcgtgaacgcgc

atatggtaaacgtcatgggtgtagtgggcggggttttccaggacgtacta

aaagcgtatcgagcgctcttttctgtcctgtagagagaaACACGTGTGAC

TGAACGGTTCTTACCATCTCTCTCTTTCAGTTATCAGCTTTACTGTAAAA

ACAGCCCTCAGTCATGGTGAAGCTCGCTAAGgtaagatattaccgtcaat

ccgttattatcgctttaaatgcagcacagatctcaaaatgcgtattttcc

tgtttttatttttacatgtggtgagaaggcccatgtgtgtgagttatatt

tagtttaaaatgtataatagtcgtcggaatgtaaggttaaatattcaaat

acttatttaaggat

hi2078 (3-5)

cagtattgacggctaaaatgagctagcgtgtgttttctgcttttcctgtt

tgtgaaggtaacatggccgaccacgcttctgcatttgcaggcctcaacaa

acacgcatcatgaacatgcgtggtgaattttaagaagactcgttttgtga

tgttgtaaaaacaaattgcgttgattaataaacccaggggaggtgttaat

atgtcgtggatttagctccaagtcatttgttcgccatgcgtggaaagtag

ctaaatgctaaacgcctccattttggctctctgtagtgaatgtgggggca

tttaacacgtttaagaccatgcactaaacacaattgcgttttaactcgtg

tttcactgtttatatgagtcaagtatgtaaatgcggcacgaaatttaatt

taattacgttatttctacttcgctgtagggttaacgtgtgttttccacgt

gttacgttcaacccacgtgggatgatccacgcggggactttcgcgagcag

tactttacttttcgagtactttattacagatccatacttaagaaatattc

attaacagtcataattttattttagtttattatttgtataagtacattat

ttacattaagtcatgcacttaatagtcaaattttaaaaggttgtaccacg

aatgaattatatgcaaaatctccaataacacgtgttacacctttagtgat

tgaaaggtaaaaatgttggattttaggaaccaatctaaatattttaattg

gtgttgtgccagtcttgtatttatctttttttttttttttttgcacattt

gtcttataaatgtattaatactaaagatgaaaagttttagatgagaatt

 

approx 1.7 kb to next exon