kinetochore associated 2-like (NDC80)

cDNA: Genbank AY648762

 

hi2080 and hi2857 are both in the 1st intron, before the ATG

 

AAACAGCCAGTGACGTCATACGAGTGATCCGTTGAGCTGCGGTCGCGGAA

ATTTTTGAAATTTAACCGAAGCATCGACGGAAGAAAATACTGGTGTAAAA

TACCAAACCCGCCGTATTTCTGATTCTGATGTCGCTGGTGTTTAATATAC

GGATAAGTTACATCTGATATGCTGATTTCTGCAGTGCAGTGCTATAAACC

CAACCGAGAAGCGTCCTCCAACTGAAGATAATAAAGGAGgtaacgttact

gtttttgtttccaaattatttatttactagttaaaggattgtttggttgt

aaagaagtaacgttgataaatgtttaatgctttttgcagacaaatagttt

tttcaataatatgtatgaataatacgtttccgtgttttttattgtcattt

aagcctgcgtgtctaacgtaaaaacaaacgttaaacgcgtaacgttatat

agatgtgcaatgcaactgtctgctataacttagaggtaactgaagttagt

ttaatattcgcacattcagactttcccttaataatataatttcataaaag

tgttagttgcaaactctaaatagcgaaatcatattagcagccagggacta

tcaaagtaacttacaactttgtttacagtcaaataaacagtgttaatgtt

gttttcaagtcatacttgcaggttatttcagacagaatgtacaaagtacc

gtggtaaacaatataaggagt

hi2857 (5-3)

gtgtcacaaattgtcactgaacgaatatgtgaatataaaaccaacattac

cacaggtgtctgctttactgtttcagatacctttaaatatcaaaattaag

ataaagtgatacgc

hi2080 (5-3)

cattgtccttcagatttattttgataacatattttgatagcacacttatt

ctgatgtgtgttcatcagattttaaaacaaatcataatcagatcctacta

atgttattatattttaaataaaaaaaacttggcagatgggtaaaatgtag

ttgtttgaataatagtggtatagtataatgatttataatcagtatttagc

ggctacaccaagatccctaaataattttttttaaatgtgtcattacatga

ttcttagccgaaaagttactgacaagattttacagacattgtaatagaca

ggagatgcattaaatgcaaaaaacacaacaaacaaaagctatctttaagt

gatattacttttattgttttgatccttgagatgataatggggaattttct

gtcttgcctgtgaaaagTGTGTTTTTAAAGGTCAAGATGAGTCGGCGTCC

CAGCAGCAGGTATTCGGAGATGCCCATGCGTGTGACAGACAGCAGGATGA

GCCTGATCAATGCCACCCCTCAAAAgtacaaccccagtcttttcttttca

tagtacattattggtctaaactggttgcataatgtttctgttgcgataaa

tgtaaaatgctaacaatcattcaatttcagTAAGGACAATGCATTTGGGA

AGCTTAACATACCTAAACCTCAGTCCACCACATCTGAGAGGCGAACCAGC

TTTTTTGGAAAgtgagtctgaacatgaaaaatcagatatgagcagatgtt

gcttgatcatgatttgtagcatttagtgcattgtattcctgtattgtttt

ttattaaacctaatgcttttctctctttacttctgcacagAGGCATTGGG

GCAGGTGGCCAGAGGAACAGCATGTTTGGTAGTTATGGGGGCTCAGAGAA

AATGAAGGATCCCAGAGCCCTACATGACAAAGCTTTTGTTCAGCAGTGCA

TCAAGCAGCTTTATGAAgtatgcttggtttgatttcttttgtatattaaa

Agattatagggtcagtttggaatcagtcatcct