RING+BBOX zinc finger protein

cDNA: Genbank AY648763

 

hi2091 is in the 1st exon

 

tgccatactttgagctagactttattgtagggatgaaagggatggcatgg

gaacagtgggacaaaggtaaagtaagaggataaacagtttacaggcattt

aggttgatcgtaggatgcctggagacgcagagtgggggaaccttctctgt

aatatttacagtggttggaccacctgattcaacctaggaaggatcagagg

gttataaggattgtaaatgggaagcaagaaaatatagggagagagggtgg

gtttgagagaacgagaagaacagtgcggctggtctgccttaaataagttt

tagggagtagtgactggttaaggaggcaaagtgaggcgtggtgccactgt

atactatacaaattatgtgtccaatcttttttttaggctacatgcaaaaa

taacacctattttaaacgaaacctgtatggtaaacacttaagacgtctat

cagtcttctagagctaaatatatattatatagaaagctaatattgaagaa

agccattttttactataataacccccaccccttcttgttttgatgacctt

atggtggatcaagcgtttattaggggagtcaatcccaccaaagccaatct

tgaatagaggacttgccacttgtcattatttggttaacatcgccctctgc

tgtcaacactcgtcgtttctgactgaaaatacagtatgtttgttctttaa

tatctggaatgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgt

gttactctgtatgtgagcaaaatttagagtatgggacaggtcacgatttt

tctttacttcttataatacctcttgttcttgtaaaattaaagtaaaaccg

attttgttatgcagacctggcaaccctgtatagaacccacataacaacgc

tcaggtagccgactaagttagttaattggcgccaactttcgtgcaggcaa

acgcttctcaagttttttcctcagaaaaatgtatcatggcgtattttaag

acgtttaaattgtaagttaaacttaactatttaatttatgtatgttataa

gcgttttaaattgtaactttattctgtccacttgcgtatgttgtcgcgta

aaacatgaagggatgcacacgaggcctgattttctccccaaacctgttcg

gttagtgagtgtctcacccacagccggtcaaactggagagacagacactc

acagctggagcacttacactGAGGAAACTTTATTAATTTATTTTATCTCG

TTTGACTTTACACCCTCAAGATGAGTGGTCGCCTTTGGACCGAGGAACAG

TTCAACTGTCCGGTCTGTTTGGATCTTCCAACCGACCCCGCGACCATCCC

TTGCGGCCACAGTTACTGCATGGACTGCATTGCGGATTATTGGAATAACG

AGGGAAGGAAAAACGGCTCCTACAGTTGTCCTGAATGCCGGCAGACCTTT

AACCCTCGTCCCACTCTCTGCCGGAACACAATGCTGGCCGAAGCTGTGGA

GCAGCTCCGCCGCGGTACCCTCAGCACCGCAGGCCGCGAGTCCATCAAGA

GCGCGCGGCGAGCAGCAAACTCCGCGTACGAGAAAGCAAACAAAGCCACC

AAAGCCACTCGGAAAAAGCTGCCGGGTTCAGCCGTGCCATGTGACCGCTG

CCCGGAGCCCAAAGCATCCGTGAAGACATGTTTGGTGTGCATGGCCTCGT

TCTGCGAGACTCACCTGAAGCCCCACAACACGCAGGAGAAGCTGAAGAGC

CACGAGCTGATCGCGCCCACCGGAGACCTGAGCCAGAAGATCTGCCCCGA

GCACAAGTATCTGCAGGAG

hi2091 (3-5)

TTCTTCTGCCGCTCCTGCCAGATGTTCGTCTGCTGGCTCTGCACCAGCAA

CCAGCACAAGGGCCACGAGAGTGTGTCCACACAGGCCGAGAGGTCAGACA

AACAGgtgggaaaaacaccacacatagacatcacctatatactgtagaac

tgcaggttaactatttttatatattataactttaattgttaaaagctttt

atttactagttaattagttcaagtttttggtaactaataaagctatggag

cgaaatcagtctcaaaaataatacatttacaaagtaaaattcatacatcc

acaacacaattaacatttacgaaatccatttttgtacatttaaaacacga

tgcaaaaatacacaaatcttattcgcgaattataaacatgatttataaac

acacaaatccaatatgtacatttcaaaaatacttaaatccaattcatgag

ttcaaaacaagattataaaatgcacaaatctttttcgtaacctcaaaaca

gttcaaaatacacaaattcattcatacattttcttttcggtttagtccat

ctatcga