caudal type homeo box transcription factor 4 (cdx4)

cDNA: Genbank NM_131109

 

hi2092 and hi2188a are both in the 1st intron

 

AGCTCCTTTTGGACTATTACACTTCCAGATAAATAGTATTGAAGAAAAAG

TTTTTGAGTCGGGCCTTGGATCCAAGTGATATTTGGCTTGATGCATGGCT

GGCATGTTGCCTTAAAAAAAGTTATTTTAGGGGTTTCTTCCAAATCATGT

ACGTTGGATACCTTTTGGAGAAAGAGGCAAGCATGTATCACCAAGGAGCG

GTTCGTCGATCTGGCATCAGTCTTCCACCACAGAACTTTGTTTCCACACC

TCAGTATTCAGATTTTACAGGATACCATCATGTGCCCAATATGGAGACAC

ACGCACAGTCGGCAGGGGCATGGGGCGCTCCTTATGGCGCTCCGAGAGAG

GACTGGGGCGCCTACAGCCTCGGACCTCCAAATTCTATTTCTGCACCTAT

GAGCAATTCATCTCCGGGACCAGTTTCCTATTGCTCGCCCGATTATAACA

CCATGCACGGCCCTGGATCGGCGGTTCTTCCTCCGCCACCTGAAAATATT

CCTGTGGCCCAACTATCCCCAGAGAGAGAAAGGCGTAATTCCTATCAGTG

GATGAGCAAAACCGTCCAGTCGTCATCAACCGgtaaggccaataaatgtc

ttttctgtagcataacaaggcctaaatgtctgacagaccgcaaaaaggcg

cagcacagtggat

hi2188a (5-3)

aattataaagttacaacatgtaaattgcgaaaattggaaggtgttgaagt

cagtgactggaaaatgaaagttcaaaatgacagacatgtttccttgctat

atatatatatatatatatatatatataa

hi2092 (3-5)

tgacaaaagtttatattatatatgaagagttcagatgctaaaaactctaa

atgctggaattttcctctgagtatttttagtgtattccagtaaatatgta

aggccaataaatgtcttttctgtagcataacaaggccgaaatgtctgaca

gaccgcaaaaaggcgcagcacagtggataattataaagttacaacatgta

aattgcgaaaattggaaggtgttgaagtcagtgattggaaaaatgaaagt

tcaaaatgacagacatgttttatatatatatatatatatatatatatata

tatatatatatatatatatatatatatataatgacaaaagtttatattat

atatgaagagttcagatgctaaaaactctaaatgctggaattttcctctg

agtatttttagtgtattccagtaaatatgttgagaaaaacgctcctttta

gaaggaaatttcagacagcacttagagggttaatctaaatttactctaat

tgtataccgaaaaaaataaatagtgtaattaatgtaatagtttttaaaat

tttgctttgatattttatatacacaaattgtgcaaaatgcaacatgggga

aaaatattaacattgtatcaggcaggcctaattgaacatctgacaaaact

gcatgccattttaaatagttttacgcatgccaagcttcacataacatttc

taatgctctcactaattctgatatttttatatcagtttatttcccgagaa

tgtttgaaaaaaatcgcatgggaaaatgcttcacaaaatgaaggtgttgg

gaattggcgccagggtcacttgtaatgctaatttgcgactcccgtaaaca

agatgtgaggtctactttcctgttacattgtctcaggttttgagggttat

ctgtcatattcaggcggcgacttctttcaacacctttttcactttgatat

gcagcagctcgtcttcctctgtctctgttcttgagggttatattacctca

aagagcgacaaatttcacagcatataaatttctgctgtctccggcgcaca

gactaaaatatcttaaagaaaacaactgcttacagagtcacacgtcctaa

ctgtaaaagacaactttgtgtgttcagttgtgctttttttaaagtaatgt

tttggaaattaaacattcagtaaaacatttgtagtttgcttcatcaagct

ttcaccgagtttgccgctaaacttaatattaaaacatttatatttatata

gttttattttcgaggttggatgcatatcaaacaagtgcagcctgctcttg

gtttgaggaaaggatttttgatgttatctcctggtaattctttgtaggac

gtatgttgtctcttaacacatcaatggcatttgggtaaagtctttgcatc

tctttgttctgcagtttgtcaaaaaaatctcagcaaagaagatcagaagc

tcaatttgcatatcgggagatgtgatcttggtttatagtaggctgctatt

gaccgaatatttaagagtttttatgaattatagctaaagaagttattggt

acagttattctgaaatcagcagtgattaatgattcaattgctaatgcaac

gatacataattatttaattgtgaatgcaacaataaatgattaggttaatt

atatcaattacattatatataaattatggcattgcaattttttttatttg

ctatgttgcttggtgattatttttttgcttattctttctgtctcagcaag

tatggacttatgtatgcctttcgcaacgatttcttcgttttgcgcaaatt

ttttcatgactattggttttattttcagGCAAAACGAGAACGAAGGAGAA

ATACCGAGTGGTATACACAGATCACCAAAGGCTAGAGCTGGAGAAAGAGT

TTCATTTTAATCGCTATATCACAATCAGAAGAAAATCCGAACTTGCTGTA

AACCTCGGGCTTTCAGAGAGACAGgtaaatatatctttttcattcatatt

tttacttttcaaataatctcacttgttgaaaacataaatgttggttctct

aatgctttatcttgtcccccttacagGTTAAGATCTGGTTTCAGAACCGC

AGAGCTAAGGAAAGGAAATTAATCAAAAAGAAATTGGGTCAGTCTGACGG

AAGCGGAGGGTCAGTGCACAGCGACCCAGGCTCCGTCAGTCCTCTACCGG

TAccAGGGTCACTGAGTCCTTCAGATATACACGGTTCTCTGTATCCAGCA

CAAATGAACGCCTTGCCGTCCATGAGGAACATACAGCAAGTTACTGTCAC

TCAGTGAACTCGAACTTGGATCATCCAACTTTAACTGAGCACTCCAACAC

GCTGAAAGGACAGAACCAAACGTGGTCAAAAAGGATTACAAACTATTAAT

GAATAAATGAATGAATAAATAAATAAGAGGCGTGGGTTGTGGATTACAAC

CGAAGAATCACGTCTgAAATGCGACGAAATGCTGGAGGCTCTTcAAATAT

TgTTTTAATAGAATAGTTTTTAAAATTAAGAAAAAAAAACTACAAAAACC

TTGTTCGTCTGATCCAGAGACTAAATAGGCTATTTTAATGGTTTGTGTTT

TCTCGAATAAGATATAAATATCTTTTTTCTGTATGTGGTGAGTGTATCTA

AATGTTTGTTTGTATATAAAATGAGAACTACAGGTACGGAGTTTCATGGg

ACGTGTAATGATCCTTACCCTGGAACTGTTAAACTTTTATTGTCTGTGAA

AACCAATGACCTGCGATGTCAGGCTGTTTTATGCGCCAGTTTGTGTCCAA

AGCGCACGTCGTTCACTTTCTTTTCACAGGGGTGATGTGCAGGTGTCACA

TACCAGATACGGGTATAACGTTTGATTTCAGCAATGTGTAAATAAATGTT

TTGCAATAACTTTTATTGTGTCTTCATGTATCATT