T-box gene 16 (spadetail)

cDNA: Genbank AF077225

 

hi2109 and hi3714 are both in the 1st intron

 

catcagcgtgtcacttcaaaggctggcaatgggggtccaagccccgccca

ctccccgaacccacttaaagatgtgggacgcctcatctgtgcatctacag

cagaggaaCTGACCTGCACTGAAGGAGCAGAAACACCAGAGCATTGGACT

TAACATTGGAATTAATCCAGTTCTGATGGAGACCTTGCGTTTGAACTGAA

ACACTTAGATACACCAGATTTAGATTATTTTCTGACATTTTCTTTTAGAG

GACATCTTTAGAGAAGGCTAAATAATGCAGGCTATCAGAGgtgagtactt

gtcttaatgcatttaaaggggtagttcactcaaaaatgaaataatgtcaa

aaataaacttacttacttgagtttgtgtcttgtttcaagtccaaatatct

aaaaactcttaaattaagaagaattttccagacaagtagaaaaaagatgt

tgtgtgttttgttttcagaaataagtcaaacttaaatgagtttttcctta

aaacaaagctaaatttcagttttaatattatacttaatccacttttagat

aattttagcttgttttaaggaaaacaaaccacttaatttcgacttgttat

tgctgaaaactaaaaaaatatgcttcttgatttgggaaatttgttagatt

ttggactagaaacgaggcaaaacatctaggtatcgattaagtgtatttga

gtttgttctgttgaacacatgagaagatatttagaagaatgctggcaccc

attgacttccatagtcattttatttccaacaatgcaagtcaatagagacc

atcaaccagcattctttaatatatcttctaatgcgcttaacagaggaagc

aatctcgggtttaaaaccacaccagagataatagtttgccactttcatca

ttttttggttttgacttggtttttgcacaagttaatgactttctac

hi2109 (5-3)

taaatcccacttaaaacatcttaaatcgcgcatcttttcctggaaaattt

caatttttcatctttttttagaactgttgcacaattaaat

approx hi3714 (3-5)

tagtttttaattgatcttgcttaaaacatctcacattgtccatcttttcc

caagacaaatgtcgtttttcatcttttttagacttaaatttgcacaattg

aatgactttccactgaatctcagtgaaaacatctcaaatctgcatctttt

ttcctcattttggatctttcttagacttggctttgaataaatgaatcact

ttccactaaatcccactgaaaacatcctaaattgttcatctttcccccga

ttttccatcttttttagacttggttttgcacagattaatgactttctgtt

aaatcccattgaaaacatctcaaatcctccgtctattccaaagatgattt

aattttcttctattttttagacttagttttgcacaaattaatgactttcc

actaaatcccacttaaaacatctcaaatcattcatcttttcccccagaaa

atttccattccctataatattgtcatttttcatcttttttaagacttggt

tttgcacaattgaatgactttccactaaatctcactcaaaacatctcaaa

tcatacatcttttccccattttatacattttttaaaactttgttttgcat

aaatgtaatcactttcacttaatcccagtgaaaacatctaaaattgtcta

ccttttccccattttccatctttttagacttggttttgcacaatttaata

actttagactagaccccattgaaaacatttcaaatcatccatctttttcc

tggacatttttcatcttttttaaccttcagttttgcacaatttaacgact

ttccactaaaaacccactgaaaacatctcaaatcatttaattttctcctg

tttttcatcttttcagacctggtttggcacaatttattgactttctacta

aatcccattgaaaacatctcaaatcatctttttattcccaagacaatttg

atttttcatcttttttttcacttagacatgcagtatataataactttttt

actaaatcccactgaaaacatcttaaatcatccaccttttccgacaattt

catgtttcaactttaaactagttttgcacaacttattgacttttcactaa

ttcccattgaaaacatctcaaactgtgcatcttttttcttagacaatttc

attttccgtcttttttagacttggttttgcacaatttaatgactttacac

taaatcccgtcgacaacatctcaaatcatcccttttttcctcagACCTCA

AGCACAATTTCAGCCTCCCTCCTCCTCCATCCATGCCCGGAGCCGGTGAT

TCCTACCATCAAGGCAATATCCGGATGACTCTGGAGGATCCCGAGCTGTG

GAGATCCTTCCATGAGATCGGCACTGAGATGATCATCACCAAACCTGGCA

Ggtatgtgagcaaaaccaagccttgaatcaacaaaacctcatattgaagg

ttcctttatgttgagtatttacgttacattgcaattagggttagggtta