cofactor required for Sp1 transcriptional activation, subunit 2

cDNA: Genbank NM_212765              

 

hi2143 is in the 1st intron

 

ttgatgtaaacatgcgtaatttcagctacttttattttatttggtcattt

gaattaacataaaatatactgatacatgccaaaccggatattctgttcgt

ccgtcttttttacaaagtaaaagtcctccagattcttcttttattattca

gttaatgtcgcagacctttttccactcatcagacagacgcaacttattct

ttaaaaaaatcaagttttgtatttctatgtactgtgaaagatatgaccag

atataaaaaacaaaaccaactattttaaaatcatacttttgccttgcaga

cttttattttaaataactttccagcgccatttagggaaagaacagttttg

tttcctgctTCAGCTCCAGTCGGTGATGGCGGGGCTCCAGTTCTCCACAT

CTTGCACGTTAAGAGACTCATTCCTCGTTTCTCCATGGGATGAAATCGCT

TCCGCTGCCTCTAAACATTAGGACGTACGGCTGATAATATTCGCTTACTG

ATTTGCGGTAAACGCGAGTGGAAAGAGTCGGAGCAGTAACCGCACATCGC

TCCCGCTGTATTTTAAAATGGCTCCAGTTCAGATCGGTTCGGACGGGCAG

CTGGTGCCCGCCGGGGGTCCGACCTCAACCCCGCAGCCTCCTCCAGGAGC

CCCGGCAACCCAAGGAGTACGGCTGAGCCTTCTGATCGAGTTTTTGCTAC

AGCGAACCTATCATGAGATCACACTGCTGGCTGAACTgtgagttcacgat

agacctgacctggacttctcgttgttttgaatggtcattggtcaggcatg

gataactgaagtttgatttcgtttagtattggcccgtatgttctagttga

caattgttttgttcagtttatgacaatatttacttgtcatgtcagcttag

acacaaatcttgactcttaaattggtaataaataatcttgaatgtggatg

tggcaaactaaccgtaatttgtattaacatctcatgaatttaattgaatt

gaatgtggttcattagaaagtttgtccaaataaatttgtgatatggtgag

aaactttagtgtgttatttattttgtaacattctat

hi2143 (5-3)

gaaataaaataaaatgttataaaattgaaggttctcagagtttcttatta

tgtagccgaagggtcatatttgccacataatagcaagttgtttcaaaatg

tgaattgttttgtgctgtcatttagatattatgtaaccatgtctttatta

ttttcacagACTTCCTCGTAAAACAGACATGGAAAGgtaagaaactgaca

taaagttaacatttagatgttgtaaaaccttattgtaaaattggggaaat

tgcaggggtccacttgggaatgctttggattcataaaaaacagaaaaaat

aattttaagaaaagataatgaatgattatgtatttatgaattgatgtatg

tatgagtatatacatattccaaaaaaaatctacctggtattggaagcact

ggtattgtgaaatacattaatttaagttttggtcattattcaagaaactc

ttaacccctaggatttaatttatgcttgcatatgagcacaactaattaaa

cccatctcttacagAAAAATTGAAATTGTTCAGGTTGCCAGTCGGACACG

TCAACTCTTTGTGCGTCTGCTTGCTCTTGTCAAATGGGCAAGTAATGCAG

GAAAGGTGGAGAAATGTGCGgtatgtgatttatctcccagtctcagcctg

attcatttatctttttattactattactacgagagactcattgttagctc

tgtttgca