DEAD (Asp-Glu-Ala-Asp) box polypeptide 55

cDNA: Genbank NM_173229

 

hi215 is in the 3rd intron

 

agatctggactccatgtgggccatttcatgactatcagctaatttgtttt

ctttcttttaccgctcaaatatgacattactacaccagcagtgtgtctgg

gatcagtacaatactgaaaaataaaaccgtaaccaacaagtgctttccag

aagtaacggcaatatagattatgtatttttcagcattcacatccccatcg

attcagacagtgtttccaacaccactggcaaaaatgcaaccccaaaccag

gacggagcctccatgtttaaaataaaaaataaatgaaactgtgtgtgcga

tttatttcttcctttgccagaccataaccaacaggctgtcggaagttgaa

gaggtgtgatatagatgccatatggtagtaaacttttcctcagcgcattt

tggcccacttgttttggcagactatgcagcgccactaatacgatccaaga

ccagcgatgagatgatcccaaggttcccataatcctggaccaggccgtat

cctgagcagctgctgtggtggttttggaggagtagagagcatgagtctga

ttcctgtgacgctccagggacagacgagtcttcgctgatgtccagcttct

ccagcgcctttttaattcctcacttacatcaattggtgaacttttttact

cgctgctgtcttgcatggttcgggaccggaggagctgcgcatcgatggat

ttgctcttcagtgtttggactcccagtagtgattattaaaccacactgaa

ctgaactgaacttagacactgaaaactgaactgacactgtttcaatttac

tatgatcttctatgtgaagctgctttgacacaatatacattgtaaaagcg

ctatacaaataaagctgaattgaatttaatcaaattgttcactccattta

aatgtattggtatgaatgcagataatttaatttgtaaataaacgttttaa

tgctataaacctttttgaattgacttataatgcaatgaaagatcaacgaa

atccacaaacgacccacgagaatgactgaggtaatgcggaacgttagtgc

cgtccatttgtttcctattcggagcatatttcctgcagcacacaGACTCT

CCCCATGTGTTTACTTTTGTGGAATAAATTTATCTAAACTATGGAAAACA

TTACCGATGGAAAATGGGGGAGTCTGCCGGTGAAATTACATGACAACATA

TTACAGACTCTTAAAGAGCTGGGATTTACATATATGACTCCCGTTCAGgt

attggattactgtttatactgtcgcatgtttcttaccttattatctgacg

tagagttggctaactccgctgtctttcatttcagTCTGCCTGTATTCCTC

TTTTTATGAGTAATAAAGATGTGGCTGCTGAGGCGgtgagtttgtatttt

atcataatgtgtaagctgccccaagaacgtgttataactatataataatc

attaattgtcatttcagGTGACTGGCAGTGGGAAAACTCTTGCCTTTGTG

ATCCCTGCATTAGAAATTCTTCTAAAGCGAGAAGAGAAGTTAAAAAAGAT

GCAGgtgtgcacacttttgacccta

hi215 (5-3)

cttatacaagcccaaatacagtttgtacagtatggaaaacgcaattttaa

agaagaaagtttctaaaacttaaacgtaattttgatttctaaaattactt

tgacatgtaattcattgcagacaatacagcaaacattatataatgtgttc

cttatggtcccaattttgg