tumor-associated calcium signal transducer (pan-epithelial glycoprotein)

cDNA: Genbank AY648764

 

hi2836 is upstream of the gene

hi2151 is in the 2nd (1st coding) exon

 

tattaattctgatttcaactgtatacatacatacatacatacatacatac

atacatacatacatacatatacaaacacacacacacaaacacacaggtag

tgt

hi2836 (3-5)

gtcataaacaacaaactgaaactgcagtgtaccagggtttgcatgtgtca

agtttcagctgaaaatcttcgtcggtactttacatttccaaaatgcagaa

aggaagttttgcgttcactctcgatgcatcaagtgaccaaatatggtcat

gggcggaaaagagagcctgtttttgctagagttgaatccaccccgtaacc

tgacgtcactttactcaaacaggtacataatttgtcacctgttgcgcatc

tagatcagacgtttGGCGGGCCAGAGAGAGGATATCTTCGGGATCTGAGC

TTGAAGAGTTCACAAGACGAGCCATAACTTTATTTCTGTGTTTCATTGGA

ATATATCTGTTTCAGTTTAGGATTTGCTGAGTCCTTTTGgtaagtagttt

tagacctctgtgttaatgattaaagtgctcttcagtaatgaataaaatag

tttctcatattaagtgatttgtaacgtgtaaacgtttatttttcagTTCT

CGCTCACAATGAAGGTTTTAGTTGCCTTGTTTGTTGTGGCATTGGTTGAT

GTGG

hi2151 (3-5)

TAACTTCACAATgtaagtaaatgttttcttactgcatacgattaactcca

gttgaattgtatcttaaattttaagccgaactaaatctagtaaaaatggt

tttagtcgttgtaacttgacgtgaataacaaccatacaatgagatctagg

gtgtggttcagtgtttatggggggtgggggttagctctacttgaattggc

ccattcacttaagctttaacagggtttaagcaatgttgacttctctatga

agagtaaaaggttaaacttttttttttttttttttttttttttttttttt

ttttctttctctctctctcttacagGGGCTTGTAAAACAATTAATTGGGC

AAACTGTGAGGAACCCTCCTCATGCATTCTTACATTAACTGAATCTTCCA

AGCAAACCCTTGACTGTTCTAACCgtttgtgggtttttattttttattat

gaaaattggcgattggcatccattttaattgtttaactggcctc