ATPase, H+ transporting, V0 subunit D isoform 1

cDNA: Genbank AY648766

 

hi2188b is in the 6th intron

 

ttgatctctttttgttttgcctacAGGCTTACCTAGAAGCTTTCTACAAG

TTCTGCACCACACTAGGTGGCACAACCGCAGACACCATGTGCCCAATTCT

GGAAgtgagtaaactacaccactacagagtgatctaattgactctgtttg

tttttttttattcatgttgtaattgatgctttgaaggatttattagaact

aaacaaagatttgtttgtgaatcagTTTGAGGCAGACAGGAGAGCTTTCA

TCATTACTATCAACTCCTTCGGTACGGAGCTTTCCAAAGAAGACAGAGCT

AAACTTTTCCCTCACTGTGGCAAGCTCTACCCAGAGGGCCTGGCACAGCT

CGCCCGTGCTGACGATTATGAGCAGGTCAAAGCTGTGGCTGAATACTACC

CTgtaagtaacatttcatagacaatattaggcctgttgcaattaacttgt

ataaaagattgtctgttgtgttaaaaaaaaaaaggtgcaattcccattat

agccaaacgtgcttaatttgtcatcatgtctgctctttcggttcaggcag

cttatgtacatcaattccaaggcattatttagtgtttgcttgatgactgc

aattagaaatctgtgcaggactgaattgttagtcccgctcctgccaggat

ttactcttcacctgaccactcccgctgtgtattcagcctttgttcacccg

ctgtccgacccgcctctttttctacccgaccattcgcgcaaaatttagac

ctggtttccaaaatctcacattaaaattgggtactaccaaaagagagaga

taacagaaaaaaatgtaggttgtgaaagaattgtagggtaaatgtcactt

hi2188b (3-5)

ttgtttgccccttgagatttcattgatgaggcataaatgccaccttaatc

agtgatgtccggtgaggtttgtggcttgtgaggtacaactctttcaaggt

cagatttgcaaacaggttcgcgcaatatgtttgccaactaccgattgtgt

tttatatttatcatatctatattgtgttttatatttatatatcatatcag

cattatttccatacatgttgccggttcattttgggccaaggaaaattata

atatgtattgcaatgtttcacattagacattgtacgatgccaaatttgta

aacatcgctgaaccctacctctaactgcaatcctcaaaattctgatgaca

ggataaagtggagcaagtaaacagatagcataactcgccatatagctaaa

gagatgtagccactatacagttaaaaaaaaagcaatttttttctaaccat

ttttccttaaaatatattttgtttattataaaaggtttgacagagatgag

tggatttactgaaaaacaattatttaaaatgaatataatgtaatttttta

gaaagcaaattcatgtctggtggcaattactcctttcattagcttctcat

gtcga

 

unsure how far to next exon