intraflagellar transport 172

cDNA: Genbank AY618923

 

hi2211 is at the splice donor of the second exon

 

attttttacgagctaaagctattaacttgaacaaatacgcaatcgctaca

tacaactattcttgtcgaaatgtcgaaaaaaatatttccaaaaacaacga

cagtaaaaaaagtaaaccacgtgtcgtttacgtaactacgtcatacgctc

tttccttGGCGACGGTAACCACGGGGAAAGCTGTGTTTACCAAAATGTCT

GCAGCCTGACAACTATTATGGCTATATCAAGAAATACGTTCTTTTAACTG

CCCTGAGTCTTATTATAAACTTGAAGTATGCAGCTTAAGTACATGAAGAC

TCTTTTAACGCCTCAGgtaaaatattgacgacgttatttagcgatgctag

ctaacgctaactagctctcggcggtccgctatttgtagtcatgatgactc

ttcttaccttagcaacacttcgaagattgtgtcttgtctgatttaagtta

gtcgtttacgttgtgcaaagaaatattaatagatagcatattctgagtgc

tgtttgaatctgagcaaaatgattacaagcctctacattaatgtgtctgt

tatggcttttctttagGATGGAGCTGCTAAAGTCACCTGTATGGCTTGGG

CTCCAAACAATGCAAAGTTTGCAGTGTGCACTATTGATAGAGTGGTTATT

TTGTATGATGAGCAGGGAGAGAAAAGAGACAGATTTACAACAAAGCCTGC

TGACCCAAAAgt

hi2211 (5-3)

aagctctcatctcgttttattagcatttttatatacaaaattaatctgtg

ttctgcaaatgtacttaattacgtatctaaatttggtaaagcatccagga

aaaacgatgaattaattgcgtgtaatttgttgcagTACGGAAAGAAAACC

TATGTGGTCAAGTCTATGGCATTTTCCCCTGATTCAACCAAGATAGCAGT

TGCTCAAACAGACAACATCATATTTGTTTACAAAATTGGAGAGGAGTGgt

aggtatctctgagaacagctattaattattcacatgttcttgttagttac

acttatggctgggccaataaacgatttttttttactctatattgatctaa

gagccagtcacacagaagaaatgttcaacaatgggaatcttaaagtgtgt

tggtattagagatgtatcgaatttttggccatcgaaaattttacggccga

aaatatgttgttacatttaatggaccctccaacttttgtgacttgagtca

ttgatggggtacccttttaattctggaagtaacaactatcgaaatctata

ttgttattggaaaataattatcgagattgcatgtttgccacaattcacaa

tttgacattttattttcacagaagttttaaaaaaatttaagtggacactt

tacttttatcaatatgacacttttgtcattttaagctgctgcagacatat

tttggttggtgttcagtgttgttttattttaatcatatgcaacaaattga

aatcaaaaaagttattcaccatatgccatatttgtaatatttttttattt

caattaaagtgaaaagctgtgcaatacccaaaccacaatttgcataacca

tgccgttttcatttttaaaccaaatgtgttctttttcagGGGAGATAAAA

AAGTTATTTGCAACAAGTTCATTCAAACAgtgagtattttgataaatatt

aaaatta