glutaminyl-tRNA synthetase

cDNA: Genbank AY648767

 

hi2216 is in the 1st intron

 

tcgactgatgcaactaagcgtcaaccgaggctgttcggtgattggtggaa

agatgcgcgaaagcaaatctgattggagaaatcacggttagtacacgccc

accgagggatggcggAAATCCACGCCTTCTGCAGGCTTTGTGGAAGCGTA

AAAACCGGCGTGTGTGCTGAAAGAGAAATGGCGGACGTGGTGTCTTCTTT

CATGTCAATTGGCCTTAGTGAGCAGAAAGCTAAGGAAACTTTGAAGAATG

AAACACTTTCATCAACACTCAAGAAAGCCATTGATCTGgtaacgttacgt

atttgattggaatacataacgagtgcttgcggtgtttcgctgtcaacgtt

tttagtctcttgaaaactttcattacagtttctctaatcactacattaac

aaaaaatagttacctaattaactataagtgattaacatgttattgcttat

gttactg

hi2216 (5-3)

ttgtgtttatcagGCTCAAGGCCAGCTGGGGTCTTCTGCCATTGACAAGA

TCACTGGCACTCTGCTGTACAGTATGGTGACACGACTTAAAGACACGAAC

AGGCTTCCCTTTCTCACAAAATACATCATTTCACGAAAAATCACAACAGA

ACTGCAGCTGTCAGgtatctgattttgctcctctggaactgttcaccttt

tgtttctcagtgta