serine  protease inhibitor , Kunitz type 1-like (spint1l; HGFAI)

cDNA: Genbank AY648768               

 

hi2217 is in the 1st intron, before the ATG

 

ctgcagcctgacgtcacgacttcctgctcgctcaggtatctcggtatcgg

acacacctgaagctACCGCAGTTTACTCGGAATTCAACGACACATTTCCA

CCGAAACTCTGCTTTAATCGACGCTTGTACATCCTGCCAATGAGGAATTG

CGCCGTTTCGTAGCGCACGAAAGGTTAAAGTGCTGTTTAGGAGgtaagag

acgttattatttaaaagttttaccgtttattttagtaacgaacacacaca

aatatgtgctgcgtttatctccggtgggccgtgtgaaatgtgtttatgtg

tgatgaaaccagtttgttcggggcttaaaacgtactttactgtgtttttt

aaagaaatgtgaacatgttagctgtttaagtattgttattagtttcggta

aagttctttaaagtttatctttcgatttcacaacgaaggcttttgtggag

tgattgtgtaattttgaccatttctgtggtttaagttttcttttttgagg

ggatattatgtgttgtgatttaatatagagacgtttttaatcttctcagg

ttggttttgagtcctaatagtgg

hi2217 (5-3)

aatttaagtaatatttatgatatttgtcagtcatcttaatgtaataatag

tggcccagttttcagaaatgatcatatttgtgtgtttattcttagattga

attcagttatcatctagtcgactcgtcgccgtcg

 

unsure how far to next (1st coding) exon