membrane protein, palmitoylated 5 (nagie oko)

cDNA: Genbank NM_194363

 

hi2226 is in the 1st intron, before the ATG

 

agatctgttcagaaacgctaggtgaaacgccagtgtggacatggatcgtg

tttattttaaaacgcagttttaaagctgaaacgtattagtgtaaacgggg

ttttagtcgctgacattatctttggcagatatggtgctaaaaccagaatg

acagacagctgtttcttacttagagctgtctatgctaatgagggagagaa

catctcgtgtgtgtgtgtgtggtttttatgaaatgtgattataaaaaaaa

aaaaaatgtttatttttaacattagaggctggctatataattcacacatc

gttgccatacaactgtgatttaacaccttataaaataatttttgcacaat

aggtccacttaaacatattttaaagattgttaaaaactaaaagacactta

tactggaagaaaaaacattggaagtcaatggtactcgaattaccaatatt

tttccaaaaatattattctgtttttaaaagaagaacgcatataggaaaag

tggagggcagtcagcccatactgtttatttagaggtaaactatattttta

aatctccatattcgccgtacatcttactaaatatcatgagaaaatacact

ttgtccaattagtttgactgttattacaattgtgtatttacaatacttac

aagtacctaatcagaacaagcacccaaaattccaatcctttaattctgct

cgatcgaaactgaccggcttgtcgttcagtcgacactgtgaagaaaaaac

ccttctgattggactacggagtttaagcgtggaggatctttccaatcaga

agcgtcgtctcatagggttgccggaggcgctgttgagccactctccgtca

gtcagtCAGTCCCGAGCCTGAAACAGTCGAGCCGTAGCGACCCGTCACAT

AACATGACAACAATATAACGTGCCATTCTGTGAACAAAACCGCCTGTTTG

GAAGTATTTATACGCTTAGTGGACATAAAGGACGGCATATGTGACTAAAG

AGgtaagctaagccactctttcaagttgttttggcccttaaaacgcggcg

tcagtgttgtttgcaacaggttgcctgggaaagaaagcaaggctgcactt

cgggaagtggccagctagctgtgttagctatgcaaatactcagcaaaaca

ttaaagcacccactcatttgtcttaaatgaagctctaa

hi2226 (5-3)

taaacattcaagggactgtttataagatgtatacgtactgcgtttcgctg

ttggtttagtttactaggaatatcaagctcaaatagctcacgttacagtc

tcaaagcctaatgagtcgcctacctagggagcatttttaggcatcattag

tgcgtccagtgtccgaaaagtggcagctcaccaggtcttgagactataaa

cctgtggttttgtattaagtaactgaaaatgaaacaaagggtttaaaatg

gcaaagttgtggattcattcacctccctatacacaacctgttgaaactgc

gtggaagtttctttaatcgataggttacacggactgccatggtttatcta

ccttcaatacagccattaggacacaagtgtcgcattgttcccttcgcatt

ggttcagaaatctgatagggcttccttttttatattgtctgtggaatgat

tactggaatactgtggatcaaacctgacatggaaagggcgttatcgtttt

attttat

 

unsure how far to next (1st coding) exon