eukaryotic translation initiation factor 3, subunit 7 zeta

cDNA: Genbank AY648769

 

hi2230 is in the 1st intron, before the ATG

 

ccatggtaggaaaaacagatacatagaaatctatgattaccggtttctat

cacttctaacatctttttttctaacagaagaaagaatctcttgaaagttc

aatacaaggaaagggtgagtaaatgatgacagatttaaatgtttgggtaa

actgcctctttaactaaggaggacttttatcttatagtcgtaaagggtcg

aaaacgggagtgacgcgttcctttacggcacgaCCTCTTGCCGCAACGTC

TGGGAGTAGTCGAGCATCCGCGAATCAATACGGATTCGTACACCAGTAAA

Ggtaagttttgcgtgtaattatgtaatacacattgttattacggcctgga

acaaaagtggcaaacagaagctcgcggcagatgactgagataagatagtt

gtcgtgtaaggagtggagcatgtgcgcttctgcttagtccgtcagctgct

tttacgcgctcaatccctccgtgccgcatttcaactctcagaactca

hi2230 (5-3)

ttgttcaacagtgacagcaactatcatgtttagtaacctatatatgtttc

caaattaagctcgaagtcaaattaacagggacggattgtgtacatggatg

tttatgagtgagtagcggcgagacttttcatcatggccgctcgtaaaatc

ctggaagatgtcgctgatatgcaactgcgcagtgtaacgtttgcagtgta

cattgattttcagcatttgacggtcttttcaagtgttatatttgcgaaaa

acactttaatatgttccgtgacaatctttatacgccaattgttaatacac

tttgagttttttttttgttcgtcagtcaaaagaatggtcgacaaccaacc

aatgagattgtagctttaggtcatgtgtccggaaccggcttcagatcact

gaaaaacgtcgagttggtggtgtcgtatgactccgtgatgaattcaagac

aatgtacattgtttactagttttattattagtgtaaaccgtattattcat

gccgtcattatatagcagcatactgttatatagtgtcaaatgcacccaag

tcaaattaattaaacaaatttttattttcttcacccacatatcatcttca

gtttgctttgcacaattcaatttgcacttggttcatttgttgtgttcatg

gttagttcggttttagaatataacacttatgttcttaagttatataatgg

taatacaattaattatgcacttttttagGCGATGGCAAAGTTCCATGCAC

CTGTGATTCAGGACAACCCATCAGGATGGGGTCCATGTGCTGTTCCTGAG

AAGTTTAAAGACATGCCCTACCAGCCTTTCAGTAAAGGAGACAGACTGGG

AAAGgtgagagctctttattatcatttaaacaaccttattagtgtttgtt

agactcttacttta