WD repeat domain 33 (FLJ11294-like)

cDNA: Genbank AY648770

 

hi2246 is in the 1st intron, before the ATG

 

ggatcgagagcatgaccatcatccgagaaatacagaatttagccctccac

tactgaaagggaagtaaacatgcagtgacgcagttgtcccgccgatacgt

ctgacgtcacgacgtcgtttcGGAGTTCACAGCAACAAGATGAGAGAGGA

AGCCTTGAGATGGAGGCAGGGGGGTGATTTATCGTAAAAAAATAGCGAAT

TTGGAGACAGTTGACATTCCGTTTTCAGAAAGAGATGTAAAAGTCTCCCC

AAGGAAGAGTCGTGTGTTAAATTTAGCTATATTAATACTCAGTCAGCACT

GGATATTTGGGTGAGTTCCTCAAGTATTGACCGGGCGCCATTTAAACACG

CTGTGCGGGAGACAGGAAAGAAATAACCGCTCTCACAGCCCGCACTCGGC

TTTCTGCTTCCGCGGACAGATTCTGCTCTCTAATAAACACACTTATTTGT

TAGGAGATTGTATTCTCAGTGTGGTAGGCAGTAGAAATGTGGCCTGTTTG

TGAAGGCCTCTGGTAGCACCAGGTATTGTGTGTGTTAGCTGGCTAACGGC

TAACAGACCTCGAACTGAAGAGAGTTACGACCCCGAGCAAGAGACTACAG

gtataaattgtgcatcatcagctgccaattcacgttttgtttcaattttc

tacgttcagtgtaaaaatgtgattataccttgttgattttcatatgcttg

hi2246 (5-3)

aatgggttctgtgttacaacatcatggtagtagtaacacgccacccaaag

aaaagacgtgaagctaactcggaaaaacaaatatactgaccagtgttggg

gtaacgcgagttacataacaatattacttttctaagtaacgcattacatt

taaaaggtaaaaagtaataatatttgagttgctttaaaaaatttatgtta

gttactttttaggttaattaattcactttaaaaataaattgctcatttta

aaatgattatagtcacgtggaatcccgcacgcaatcagatactgcaggga

cagacaga

 

approx 4.8 kb to next (1st coding) exon