splicing factor 3b, subunit 5 (subunit 10)

cDNA: Genbank AY648771

 

hi2271 is in the 1st intron, before the ATG

 

ctttccaccagagcggaactcttgactgcagtgatattttccacacatac

agatttcagagtaactatttccGGTCCGGTTGAAGTCACCTCGCACAGCC

ATTGTGTACAATAACTGCTGGGGGAATCATTCATTCGTTTTTCCATAAAA

CATCACAGTTTTTCATTATAGgtaagcataccgataatatttacagaaat

acccaccactagttttagccgaaggagaaaaataattgcattctttgaag

taatgtaattttgccacattcgcatacctaagttagtttgttcacagcgc

aacgttagcttacgttatgatgattggtctttgttttaatttatgaaata

ag

hi2271 (3-5)

ttatttttttcttttcatatttttaaatgttcataattttgaataacgca

cgcatttagtcatactgcgttaagtcaagcgtgctttcagggtgcccgcg

gagacctaaaaagatagaggtaacgttaaagttagttttatattagcaca

ttctgactttccccttaataatacagtttcataacagtattatttgcaaa

ctctaaatggcgaaatcgtattagcagccaatgactttcaaagtacaaca

ttgttccctgtcaaataaacagtgttaatgttgttttcaagtcacacttg

catgctaattccgatcgaatattgaaagtaacatggtaaacattatagac

acatctaaatgaacaaatgtgtgaatataaaaccaactttacctctaaca

aatgtttgaatataaaaccaactttacctctatcttaaaaagtcttatat

ttccaaaacacaattgtagaccttaaaaagtcttaaatttatttaaatat

ggtattgtaggtaagcctcaataattttaaaacggtctttaattttcctt

ttttgtatcaaaggttacccaatcaacccaacacacacccaatcattaac

aatacatctcaattaaacttttagcaaagctctatttataagcaatatta

taacatcgtgttgtgcatacaatagtttattaaattttttaacagttatt

ttttttaagttatgttgaaaaaaatgcatatatacaactagggtctgctt

tatttgacacattatttaaaatatatataattttatttttcctgcagggc

cattaaaaaaaaaacctattgcgtttatacctatatgtgtctgaaatctc

attcttgatggtcttaaaaaggtctttaaaagttttaaattagacctggt

gaaacctgcagaaaccctggctttgtaaatgtgcaatacctctgagctac

aacaacatgctaaatgatccacatttgacttctttggtcaattttatcaa

tctggatttgaatctgcatttatatcccaatgcgtctttgagactaaacc

gtatagcgctttacgaagcaagaattcaaatggaatgcagtctatgtgta

gataaagatatgtagtacttgtagaatactgcatacttgcatactgttat

gcaaacactggaaaaataagttatttatttttgttctatgctattgatca

gatctgtattctagtttgaaacataatgcatttatagtttatttttaaat

ttgttaattttattgatttacttattgcgctacattaaaacaaacctgtc

tcctaaaacggatcataaaaggccctaaatattactataccgtaatagta

gtttttggagaacaacaaaataaggatatttagacgtttacaatggctaa

aacacaaaattcttcctatttttgaatcagacataccaatgtgtttgtaa

aataataatgatttgattatttttattattttacaagcacattagtatgt

ctgatacagtgtcatagggctgcatgatattggaaaaatttaacatagtg

agttagattgattaggatgattgtaggggagtgcatatgcataaaatata

aacgatctacaattaacaaaaaaaatggaattatataaacagcgttttat

tgttgttccaggagtcaaactgtgatcaggtatacagtaattaaaatgta

aaataatactgcatagtcttcgtattagaaccaattcaatagaatttgtc

aaagttaaaaacagttcaatttctgaggcctgcacgcttttaaaactctc

acagacccttaaaaaacacttaaaaggatgagttataatccaagctcaac

ataggcctgggcaatattgcaaaaaaaggatcacaatatcaggttttata

tagttcgatatagataactattgaatatttttaacagtacatttgtgaat

attaggatttgttttatttaaccactttattttaatttaccaacattact

gaggcaaatagttttaatagtcaagaacaaaatatttaaacagactatct

gatctctttattatataaatataagtggtaaagaaactcctaaacttgat

aaataaaatgttaaaaagtgtacacaatggcaaagagtaaacgctgaaca

attaaagcaaactttgaggtttactgtatcattattcataccttaaactc

tgtcaacaaaacaaattatgataatcaaatctgagctttcaagtaaagaa

accgaccatcattattcaaatacatgttacaaaattgtgaggttgaatga

cttcattacccactaagctaaaaaaaatctttcacatggggagctagtgg

ctgagatgcacaagaaaagaaaccagaaagactctctagcgacatcctta

catcctttttatttacaatctcttcactgctgctctatggcactcatttt

atgcctgctgttattctgacctgaagtaacatgcgtgtgctttgtgtgaa

gctgactggttagctttaggacttgcggctttcttaaagttctgatgttt

ttcatttaagtgtaccttgaaaatgcgtgtgttgcttgcacaccatgtgc

acattgctcccatgtgcgtgttgtgcaactcgcgcatgcaccttcattga

aaacttacaccctaagcttattggcattgcttccaaggcacgtgcccagc

agccacatcttaataaaactataacgcttcataccaaaacttcttagcag

acattttttattatcgatattgacaatagtgtttgatcagtaaataccga

tatccattttatcacccagccataattcaacattgcatatactggcaata

tggctattgcgaatgtttacattgcgatatcaatgctgaaacgatatatt

acgcaatcctaccatgtcgctattattgtcttgtctttatgcaaatttct

ctcttgtacttctggtagggttatttttattcaattttaattgttgtttt

gtcttcgtgtcagAGGGAGAGGTTTTCTAATCGAAGATGACAGACCGTTA

CAACATCCACAGCCAGCTGGAGCATCTCCAGTCCAAATACATTGGCACGG

GCCACGCGGACACCAGCAAGTGGGAATGGCTGGTTAACCAGCACAGAGAC

TCGTACTGCTCCTACATGGGTCATTTCGACCTTCTCAACTACTTCGCCAT

CTCAGAGAACGAGAGCAAGGCTCGGGTGCGCTTTAACCTAATGGAAAAGA

TGCTGCAGCCCTGCGGCCCTCCAGCTGACAAACCTGAAGATGCCTAGCAC

ACTTTGGCTGAATTCATACTGCTGCTGAAGAGATGTGCAGAAAGATCATA

TGGACTCATGCTGGTTGTTTAAGAACCAGTCTATGTCTACCTGTCTGTTT

TTTTTAATGCTGTAATTTTTTGTGATATTTTTTTTTTTGTATTGTTGAAA

AAAATAAAGTTGATACTCTTACACACAttcattggttttattgtttttct

taaaataaaaagccaataaatggactaaacaaaaaagaaaaaaaaaatca

tatcttgacttgcatccagtggtgtaaagaaacaaattacaaatatttta

ttttcttagaaattgtaatttacttaatagt