syntaxin binding protein 3

cDNA: Genbank BC058874

 

hi2285 is in the 1st intron

 

ataattaataaattgttgtaggatacagtgtcacatattattatgacgtg

cgtgtccaacgctgtatcccctctaaatattttaatttgtgtgtgtgtga

actatccctatgattgccggttgacaagtgggaaatgaataacatggata

taataaaaaataaccataaataggccaaatatatgaaacaaaacgcttta

aaaacccagtagtcctatttaaaaatacattttgataaactgcaagattt

aacaacgacaaacaaaaatcactgatatcccatgacttatatatattcct

aatgtctgaaataccgcttttaaaattccgtgatgtttcagaaattcatg

acccgtgggaaaaagcctgtaaaaaaatctccactgaaatgaattgtcca

ttcgtgaacgcgcgcgcgcgctcactcactcactcctccctgaaacagga

gcgcgcttttgcctggacAAACTTCAAGATGGCAACTGGAGCAGACCACG

GCTTGAAAAAAATAGTATGGCAAAgtaagttcatagagctgacatctgtt

ttctgcaaacctgttgcgtgcacggcctcgtgcttcaacacttacacgag

ttcggctcagagaaagagctgtcagaagtttaaagagacacacagtgttt

actgggtttgcccagaggagttaaagtagtttcaaaagttgtttatgcgt

ttgttttttcgtgtttaataacgacacagtgccgtattaaatgtttggcg

tgaatcgttgtcatgtttgttctggttaaatgtctcatgtgtcattgagt

cactgtttccgattacgttagctgctctgctaatgttagcctacccgttt

cagtttctctttttaatattggaagcagatttatttatgtcgtcgttact

tttgttgacgtaattgtttggctgtctgatgatgatgtcataaaggcaca

tcagtcctcccgcgctactttctgtgaacttttattagtgacttccggtc

tgctgtgttgtgacagtaaagttataataacata

hi (3-5)

attatataaaagttaccaataacacgaaacaagaggctttccaaaattca

caaacttaggtttgtgttttattctgctaactaaacctctttatagaggt

aacgttggttttatatttgggtgttcagacatttcccttgatataattaa

aaatattaatgatataatttcagaaagtattctttgcaaattctaaatag

ggaaattatattagcagtaaatgactatcaaagtatgggcaaggcagtgg

cgcagtaggtagtgctgtcgcctcacaacaaaaaggtcgctggttcgaac

ctcgcctcatttggcgtttctgttctgtgtggagtttgcatgttctccct

gcgttcgcgtgggtttcctccggttttccccacactccaaagacatgcag

tacaggtgaattgggtaggctaaattgtctgtggtgtatgagtgtgtgtg

tgaatgtgtgtgtggatgtttcctagagatgggttgcggctggaagggca

tccgctgcgtaaaaacttgctggataagttggcggttcattccgctgtgg

caatcccggattaataaagggactaagtcgacaagaaaatgaatgaatga

atgaatatcaaagtacagcattgttcacagtcaattagacagtgttaatg

ctgtttaagtcatacttgcatgcttattcagatagaatattcaaagtaac

atggtaaacagccccaggctgggctacttggaggagttcagatcacccca

ggtacataacctaggcataacattaaaccagaacttaaaatttgataaac

agatct

 

approx 3.3 kb to next exon