DEAD/H box 51 RNA helicase

cDNA: Genbank AY648772

 

hi2161 and hi2289 are both in the 1st intron

 

agcgatgtatttcatggattcataatataaatagacacacaaacacacac

gcttacataaagtacttaccttcaactattttcccaactgaagccttttc

cctccacaccagtatgagtatttcataaaagtaataattttcttttctgt

tcgttgaaattgatcaattgagtaaacattgccatctggtggttatttgc

ttgtaaatataattattgtaatgaataattcttcctaaaaaaagccagtt

cctttaacagcttttctctctcaccgccattgttttattttaggcgattt

tatacatgaaatctaaatgtaacacatcaaacgtaaacaaacgttcacgc

aactgaatttagtaatcacaaactaatgtgattggccagtccttctcagc

gcagagaatagtacgtgttccacgtgacaacacattcatcgaaattagaa

aaatatttaatcaacgacgatttacaacagaaaaactactgacaaacttg

accatttataaacgccgactagaccaccagcatatggtaaccagcaaata

gtaaaacaaagatatcttttactttaccctgttatatctgtgtaaaagtt

agctacgtcatagcttcgcgacgccGAAACCCACATGGCTAATGTACAGT

GCATATTTTTTATCTTTAAAACCTGTACATAAGTAAAACAGTTATAATAA

TTTGTAAGTAAGCGAATTAAAGGATTAAGCGCAGCTGACAAGAGTCCCTA

AAATGGCGCTATTTACGATAAACAGgtatgttggtatatat

hi2161 (5-3)

tgcactttgtttactttgccgacaagaagttctttaacgttattgtattc

ttaatttattttatcggtgcaattataaatactacctttagccctataat

aacacattcgcagtgacaacatatgtcatgctcccgatattgtttacgat

ggtactttaaatattcggtatgaa

approx hi2289 (3-5)

attaaatttaaatatgactggaaaacaacattagcactataatttgttgt

agtttattttacattagcagaatattttttgtgtgaaattaaattattaa

ggagaaagtttgaatgtgcgaaaataaaaccaactttacatcaattaatt

aattgtgcaagttaatctcgtaagattttgtttatcttacatttataaat

agttttttctattaatagcacctttaataattcatgtattattattatta

ttgtgcatggctaacttggctagaacctatactctccgtttggcataata

atcaagtacttttgctcaatgacatttacacaaataaatgaaaatagttt

gaatcgagtctcacaaatgtctccattgttgcaagattttcaggagctgt

ctaatataatatcaatcaatgatttatgctaagctaagccaaaggtgtcc

ctgccacctagatattgtctgaatatataaaaaatgtaaagaagagtttt

aaataaggaaattatcaaaagtctggtccttttgagcgagatgctaatgg

tcaaatctgatttaatgatttatgctaagctaaaagcgcttcagctagac

ccggagatcatctgaatggatttaaaatgtaactacagaatagtcacgct

tcgaaaagtaaaattaccaaaactctggtcattttgagcaagatgctaat

ggtctaatttgattcaatgatttatgctgagctaagctaaaagcactcat

gcctgacccagagatggtctgaatggattgtaaatgtaactacaaaatag

tcaagctataaataggaaaattatcaaaactctttggtcatttttgagtg

agatgctaatggtctaatcacattcaatgatttatgctaagcttagctaa

aagtgctcccgcctgacccagagaacttttgaatgtattgcaaatgtaac

tacaaaagagtcaagcttttaaatagagaaattatctaaactctttgatc

attttgagcgagatgctaatggtctaatctaattctatgattcatgctaa

gctaagctgaaagtgctcctgctagacccggagatcatcaaaatggattg

aaaatgtaactttagaatagtcaagctttgaaaagggaaatcatcaaaac

tctttgatcattttgagtgagatgctaatggtctaatccgattcaatgat

ttatgctaagctaaaagcgctcccgccagacccagagattgtctgaatgg

atttaaaaatgtagctacaagacccggagatcttctgaatagatggcaaa

actcaatggtttaactcagttttagatatcctatttatttatgtttttta

agtggagtgttccttcatctgatgtgatactttgtctattgatgttgtga

tcagGTATTTGGGGGAGGAGGAAGAGGAGGACAGTGAAAAGCAGTCTCGC

TCCAAAGCTTTACTGGCTAAACTTCAGAAGCAGGTCAAAGCCAGGGGACA

GCAGAGCGTCTCAAACACACCTAAAGAAAAAGAAGAGCAGCAGGATGAGA

AAGAACAGAAGAAAAGAAAACACAAACTGCAAGAGACGAAGGGGAAAATA

AAGAAGAGTGAAAGTGTTCAAAACACAGATCCTACTGAAGAGGCTGACAG

TTCAGTGAAAAAGAAGAAAAAACGCAAAAAGTCATTGTCCACTGAAGATG

TTATTGTGAAAATAGgtacagtaatcctgtcttgctactatgttcgattg

tttaatgatttttattaatgcagtttgtatttgtaatataatatgtttat

gtattgagt