smoothened

cDNA: Genbank AY029808

 

hi229 is in the 5' UTR

hi1640 is in the coding region of the first exon

hi2329b is in the first intron

 

atatgttaagtccagtccagacttttaaggCAACATTTTTTCCTCCATCC

CAAAAGTGGGGGATGGTGAACGCTATTTGGTTTGTTCTAACTTTTCCTGT

AAGAAACTGGAACGGAGCAAATCTTGGCGCTGAACTTACAAAAAGAAACT

TTTGTTGACAACTTTTTGCGCACCGCAATTGTACGATGAACAGATTTTCA

ACAGTATGTGCCCGAGAACGGAGGCATAAAAAACTTTGGAATCGGACTAA

AAGGTGTTTCTTTTAATAGGAAATTTTGTTTAATCGCGATTCTATGTCGT

ATC

hi229 (3-5)

CAAAATTTGTCGTGTTTTGAAAACTCAACGCGCATCGCGCACGAGTGGAA

CTCGCAAGTTTATTTGGAAACATTTGATGAAACATCGCTACTTTGTTGCG

TCTCCAAGATGTCCTCCAAGCGCCCCTGCTCCATTGTTGGAAGCTTTTGG

ATGCTTTGGATCTGGACAGCTACCTCTATGGTCGCCAGGGCGGTCATCTT

GCACCCAAATGAAACTATCTTTAACGACTTTTGTAAGAAATCTACAACTT

GTGAAGTGCTAAAATACAATACGTGCCTAGGCTCGCCTTTGCCGTACACG

CACACGTCTCTGATTCTGGCTGAAGACT

hi1640 (3-5)

CAGAAACTCAAGAGGAAGCCTTCGAGAAATTGGCCATGTGGTCTGgtaag

ttaaaattgttatataacacaaatgcagttaaataactttttaattatgt

tctcattcagactaaggtttgtgttgcataataaaataa

hi2329b (5-3)

aattgagctgaataaaataaaattgagctgaaaacactgaaattgttcct

atgcaaaatattattttatttatttttgtgtttagattaaaattatatat

tagaattaagttattaaatagaccctaaaaagacaagtgttgttattaat

gtcttgtgttagcacatcagcgaaaataaaatcatatgtgcagaacaata

tattaacttttcctctcaatgatttttgatttcacattacacaaattaaa

ttacattaaattacaataaactacagaatgatagtcttccatgactttga

catcagttatctgtgccatcctgttcttaattttcacaagcaccccataa

tgagcaatctcttcatttccttctcacattcacaccttaatcccaacttt

ccatgcattgtcttataggcaattttctttacatatgaaaaagaaaacct

aaccacatatttagatacacaaaggacgttgttaaactcctgattttatt

ttataaatattttgtatacacaaaccatttagaattatgcactctgattt

aatagcattgattagcatctaatcatccagtctcatctgcccagGGTTGA

GAAATGCTCCTCGCTGTTGGGCCGTCATTCAGCCGTTGCTGTGTGCCGTT

TACATGCCAAAGTGTGAGAATGGAAAGGTGGAGCTGCCCAGCCAGCACCT

GTGCCAAGCTACACGCAATCCATGCAGtattgtggagcgggagaggggct

ggcccaacttcctaaagtgtgaaaacaaggagcagttccctaagggttgc

caggtaagtcatccatttgtgtacacc