cDNA: Genbank NM_130973

 

hi2293 is in the 1st intron

 

gcaaacgcagatcgCGCACCGACACTACAAAACATTAATATACACGCAGA

AAACTCCAGTCAGAGTTCCAGAACTCGCCGAACTACACTTTCTGAGAGAA

TATTGTCGATCTGTGCAGTATTAGTAGCGATAGTGTTTGTCTGAGGAGTT

GAAGGTGGTGTGGATGATGGAGGGGCTGCTGTGGATTCTGCTGTCCGTTA

TTATCGCATCTGTGCACGGATCGAGACTCAAGACACCCGCGCTGCCCATC

CAGCCCGAGAGAGAACCCATGATTTCCAAAGGATTATCCGgtaagggagg

aaaaacaaccttatataacaatactgtaacctacaaagtacagtacagct

tccttttacaagttttagactgtgctcttgagtttgtagctagctatatt

gtaatttggggttatctttaaaaaacagatgctttaaaataactatat

hi2293 (3-5)

aaatatagttagcatactgaaatattttctatagtgaagaggtaaagtgt

aatactgtattatactttagtttctactcttttgaggtaaagttggcttt

atcttcacatatttggactttgtacttaataatataatgccagaaaagaa

gtattatttgcaaattcatgttagtagttaatgacaatcaacattgttca

cggttaaataaatagtgctaatgttgtttttaagtcatacttgcatgtga

tttcagacccagtatttaaagtagtgtaataaacaatatagacactgaca

caagatttcacatgaaaccagctttacctcatctatattgttattaggaa

gctaggtttacatttaaaacaacagatgccttttaaaaaacatagctata

agtatatctatttagctatagtgcagtgtattattctgtatagtatttac

agctctttaataatgtacgctccagcattctgtagtattagtgaagtgaa

aaagtgtaataaatactggattatacttcagtttctaccgattggggtaa

agttggctttatcttcacacat

 

at least 2.3 kb to next exon