RNA binding motif protein 19

cDNA: Genbank AY648773

 

hi2329a is in the 1st intron

 

atatattttatgcttgaaagccaggacatacaaaataccaagcagcatta

aataaatcttaataagtgttgttttaagtaaagtagcttcccttttaagg

aaatatttcgcttatgtccacaagtgggagccataatcaagtgtctttgg

ctacgcgctttacgtcACACAGTAAAGATGGCGACGCACTAAAGGGCTCC

ATGCTTTATTGTTGATAAAACCATACATTGTTATTTTACAGGAGAAACTC

TCACTTGGCTCAGAAAAATGTCAAGGTTAATAGTCAAAAATCTCCCGAAT

GGGgtaagtattcataataatattagtatatgatagaactctgctgtcaa

gtatgcatgctttacgttatacgaagaagtgttcatctaacgttacagac

acgttt

hi2329a (3-5)

atttgttgtatttactcacaaaaagtaacacaaaacgactgtggtttagt

ttgacgtgctgttgagctacagtggctactaaaagcagaataatatctaa

cagttacattacctattgacataaagggaaaagttggttttatatttaga

tatcccgacattctccttaataatataattttattaaagtattctttgct

aattgtaaatagggaaatcaaattagcagcaaatgactatcaaagtacag

cattgttcacagtgaattagatagtgttaatgttgtttagaagtcatact

tgcatgctaattccgatcgaatattcaaggtaacatggtaaaaaataaga

cgttagagaacaatatgacttctaaatgaacgaatgtgcgaatatgaaac

caactttacctcagccctttagactccttttgaaaatttgagtaaaaccg

taacgttagtaactatgttttttggctcactattaattttataacctcag

tattacttcatatactaacgttaacgttattttaaaattatgattcgtgt

agcaaaatcatttgccagttgtggtcatacatagaggtaaagttggtttt

atattcgcacattcgttcatttagaagtcatattgttcaccaggtcactt

tgaattttcgattggaattagcatgcaagtgtggcttaaaaacaacatta

acaatgtttatttgactgtgaacaatgttgtactttgatagttgttggct

gctaaaatgatttcactatttagtgtttgcaaataatacttttatgaaat

gatattattaaggagaaagtctaaatgtgctaatataaaactaactttac

ctcaattggttatacatggtttaactagagtaatattgtttttttgttta

attttcctaagggacagcaacagtgtaacattgtactattactgtacctt

cttataatcctcattaattaaatcaaaacgagtttatttgattcctctag

gctcttataccaggcagttttgtgttcttaaactgtatgtgtgtgcaatg

catgtcatttgatctgctgaaaagcttattatttatgttgtgtctccagA

TGAAGGAAGAtCGCTTCCGTAAGATGTTTGCAGATTTTGGGACACTTACA

GATTGTGCACTCAAATTTACCAAGGATGGAAAATTTCGCAAATTTGGATT

TGTGGGTTTCAAGACAGAAGAAGATGCACAGAAAGCTTTGAAACATTTCA

ACAAGAGCTTTGTGGACACATCTAGGGTTACTgtgagtgacaagatcatg

gagtgttttcaagcatttcaaaacaattctaaaactacaatacagatttt

atcccccaatgttaacttgtactt