phospholipase C, gamma 1

cDNA: Genbank NM_194407

 

hi3479 is upstream of the gene

hi2335 is in the 3rd intron

 

 

agatctgtgttctctgaactcctgtggacgtcttcattctgactgcttgc

cgcccgaatcgcgtcatagctcattaccataaagttgacttgatttcagc

tctcctcgatgcccacgccggcaaagatgcgcagcgctgctcctcgctgc

cggctctcattgaaaatgaatgacctccagctactttgatgctctcgccg

ctttcggtgtgaacgtacggtcataacggcagccagaagagagaacaacg

tcaaatgtactgtcccgctccatagaagacactgcataacaaacacctca

cacaagtggtcattcattttgtgtaatttgacacaaatattataccatac

atatgtaaatacatataaatagacatactgtatgtttaaaaaaaatctaa

atattaaaatctttcaatgctgatgagcgttaaacatcttgtgtaagtgt

ccgtgtgaaaggttatcaaaccagatatcttaattgcttaattagttatt

aattactcgttttgacgtaactcaccaaacactggacttttgctgtgctt

tcttccatacacacttgaggtggcagtgtgcgagtgctgaaagtgcgcac

tgtgtctttaagaggccgtttgctgccccggctgcagggctcggctggtg

gggggaagggcttcactcagcagctcatggcggagagaagaaactctccg

tcggctcgatcaccgcgccgatccgccaacacggcagagcaccggacgac

atgagcctgcggagattgcggacagtcagcgtgtgtgtttctgctttcgg

cgagtccacagagctgctgcatacagacacggtgagacataacagacctg

gcttattattattagtaactgttagtagtattatcatcatcaccaccacc

tccgtcagctctgctaacaatataggcgctgctccg

approx hi3479 (5-3)

tagcttcatatacagccttcctgttctcatctgtggagtaaaaccgcgac

gacgacctcttattaataaagcagaatctgtgattttttttctctctctc

gttgtttgctcatcaaaataaagcgttgttggtcatatcgaagcaaatca

cgcatcataagtcagatcaactcaatttaatctacttaaacatactagaa

ttgaatgattagctttgattaagatctgctgttcttgtgtgtgatataat

aatattaataatccgttatgctctcataatcaatacattaatcacagcta

atgactgtgtatttttaaatatataagtataaattagcatataggtgaag

tgtgaatgtacacatgtggatgtattgtacagcaggcctctctctatgtg

tgtgtgtgtgtgtgtgtgtgtgtgagctctcctttatgccttacatttgc

tttatgtggtgtttctgatgcttgtttttgctaggtgtcctgtgagcgtt

tctgagaggaactgaaGAACAAACAGGGGAAATGGCTGCGAGCGCGGGCT

TCTCCTCCAATGGACCTGTACCCTGGGCTCTGAGCGACACCGAGGTGAAC

AATCTGTACCGGGATCTGGAGCTGGGCACCGTACTCACGCTCTATTACTC

CAAAAAGTCCCAGAGACCCGAGAGGAGGACGTTTCAAGTCAAGCTCGAGA

CCAGGCAGATTATCTGGACCAGAGGAACGGATAAAATCGATGGCGAAAgt

aagttccctatgctaatcgctgcgggtttggattcagaaaccaacagttt

tttttaaaaagccccaaagtgtgtgtcagttttctggggctcgtttttgt

tgtgttgtccatgactggagctgttagaaccaaaacatac

 

later in gene

 

aaaatatgaagtggtaaatgaaaatgtgaatgaattaatgaaatgggaat

gaatgaatgaatgaatgaatgaatgaatgaatgaatgaatgaaaatgtga

acaaaataatgaaatctgaatatatggttgaataaaaacatgaatgaatg

aatgaatgaatatgtgaatgactattgaatgaattaatgaaaatgtgaac

ggattaatgaaagcttgggtctctcagccaaaccatttattatcatccat

ctgctcatgctggttgtgtgtctgtgtgtgcgcagCGACCTCAGACGAGG

AGATGGTGATGTGGGTGAAGGGTCTGACGTGGCTGATGTCCGATACGCTG

AGCTCCTCCACACCGCTGCAGATTGAAAGgtgacctccgacccctgtgtg

cactgcaccacacatatattgaccaatgcagattttaacctctaccttca

ccatgggtcatgacgagccctgtatactgtgtttttaataggacaaaaaa

aagaaaagaaaaaaagagttatatgttctaaacataaagtgcacgcacca

attgaataacttgacccctgccttaaaataatcctagatccaccactgct

ccagaaccaagatttttgaccttaggaataattttcagcagagtaattat

tgcagtgtagagtcagaattaatc

hi2335 (3-5)

tcagtctaatgttttaatcacagattggtgaatcagtgtttacaattcaa

ttcacctttatttctacagcgcttttacaatgtagaatgtgtcaaagcag

ctttatatagaagatcatagtaaactgaaacagtgcagttcagttttcag

tgtttaagttcagtttagctcagttcagtgtggttaataatcactactga

gagtccaaacactgaagagcaaatccatcgatgcgtagctccacaagacc

caaaccatgcaagccagagatgacagcgctgagaaaaaaacttcaccaat

tggcgaaagtgaagaattaaaaaacctatagagaaaccaggctcagttgg

gcacgaccatttctcctctggccaaacgttttgtgcagagctgcagtc

 

unsure how far to next exon