GTP binding protein 4 (NGB)

cDNA: Genbank AY648774

 

hi2345 is in the 1st intron

 

tgagcgcgtcatcggtgttccacgtgttttgctctccgtgacacgcgtcc

gctgcgtgtttcggcCCTTCCGCGTGCTCTGTAGAGGCGACGCGTGTGCC

GCTATCATGGCGCTCTACAACTTTAAAAAGATTATGGTGGTTCCCACCGC

AAAGgtaggaaactaacgccgttatttcatttttgtttgtgagtgtaaat

tatatacaaagttaacggagttgctgt

hi2345 (3-5)

caaacgcagacactgacagcattgtttcttcttctgtacacacgtgcgtg

cgccgtgagccatttaactagtcatctgttgtatttcatctgctccgtta

cagtcaataacatcttattgacgtcatgtgtgaaactgatttatgggggt

taatatatttggagtgttaacaagatgagaggttcaattagtctcaggtt

gaaataactgatctcctgatttgtattgtcagttgttctgctgaagtctt

cagatgcgaatgtgtgcaaaggttataatgataatggagagcctggccgt

ttcagagaataataaagtttctattcatggaccataatctatgttatgta

aattattggcttgaaaaattacaatgagttatacaatgatgctttaaatt

gactggaaatattgtcaagaaaaaaaatcttaaaaagtctcttgtctaaa

tatctggctggaaaattaagtacaagtgacgttctaaggaataataaaac

tatttctttgcttgtttttcttcattcagGACTTCATAGATGTGACTCTA

TCGAAAACCCAGCGGAAAACCCCCACTGTAATACACAAACATTACCAGAT

CCACAGAATAAGACATTTCTATATGCGCAAAGTTAAATTCACCCAGCAGA

ATTACCACGATCGACTGTCACAGATCCTCACAGACTTCCCCAAACTAGAC

gtaagtcacatttcacaacaacaacaacactcgggacaaagatcacacaa

cgctggtcctccatctcgcttaatgcataaatgacttcctatgtgtcttt

ctcagGACATCCACCCATTCTACGCTGATCTGATGAACGTGCTGTACGAT

AAAGATCATTATAAACTGGCCCTGGGTCAGATCAACATTGCTAAGAACCT

CATTGATAAgtgagtctcttgtttatatgtataactttagcacttcattt

attgttcaaacacgcagtcaagcctgaaatt