NADH dehydrogenase (ubiquinone) Fe-S protein 5

cDNA: Genbank NM_001020633

 

hi235 is in the first intron, before the ATG

 

agatctcggcttgatcgcatttgctttgaaccacttgaaccacctgctga

atttgcgtgaccttattttcatttgccttaactcgtgtggacatcgattt

aaactcctctccgacaaaatcaacagcctttgaaagattagcaatcgtaa

tcgaattctgggcaagttgttgttccatcgacgcaaatcgatcactgagg

gaattaacagcacgcagtatgtcaacattagacactttaggatcatcttc

atcctgacaaagtttttttgagagaggactgcttgatggtgtatttgaca

acgaatcgtggtctccagaaggttcgaaaagcgaagagaacaactttcgg

tctttactctttggcatttttgcagacggcacgtgcactgaactcttgaa

tctgcgtatagttcagtctataactggggtttagacatcgaaattagctg

agttactacttataaaagtccccaccttgatttcagtgatacatattcgt

ccaaacaatgtaaactcctccagatggctcagagctcaaaccagcacaac

cgtctaggtcgccatcttgcgccaaccctaccggtgcatttttatttatt

gtactttgcagcagtgacgtaaaatgcattgcgctcAGTTACGGCAGCTG

AGAGGTCGTGAGTGAACTGTGGGCCTTTGGAAGGTTAAAGTGAACCGGAC

Ggtcagtgtttgtatttacaattttggagctttgtatcatacatgtgcca

tccataaaattgctagcactaatgtgaatccgatgctgtccgtaaatgtc

attagaataaacgcattctgctgtttagttatcagacctcccgttaggct

atgatgctaacagt

hi235 (5-3)

agctaaactacgattatcaatacatttcacaacgctgcaaatgttaaata

gcatcacgttagctgtttctaattgttaataattacttgattcaatcgaa

tgacttatttaacgcttgattatgaatatgtatccagattcaggtcaggt

gttgtattgtgttgtagctaaataagttatattagattaatg