LTV1 homolog

cDNA: Genbank AY648712

 

hi239 is in the first intron

 

taaaaataaataatccgttattcactgcagttctccctacgctttcagtt

cgtcgtgatggtagagtctcaaaatggccgctTCTCCTCCATGTGTTTGA

ATGTGACAGAAGGATCTTTATTATTTAATTCTTCGTTGTTCACGCTTAAC

AACATATAAAATATTATTCAGACCAAAAACGCAAACGTATTGATAATACA

CTAACTTGTAAAAATGgtgagtaacctttgagttgttgtact

hi239 (5-3)

tcgtgttgttagctgtcaggctaaggactacagtgtgtaaatcacatgtt

attaagaaactaggacttttaaacattaattatacatatacattcattgt

ctgtttgctaaaaaagtcgattgaataaaatttaggttggatttggtgac

ataacatcatttgtgttgagttagcaagctgttttattgtaatagggagt

ttgtttatatcgataattatcacgacaaatgttttctttcgcattttagg

cagatttttgcgtatggtttaaagttgtaaacagtcccttttacttataa

atgactgttttattgtcagaacatgacaaatttcccaaatctgacgtaca

atattattcataaaatatttattaagtttaaatttattttgcaacctatt

ccttattcgaatattttaccagatacattaatttcttagaggttaaacat

aatcatgaaacaaatctttattattcacgttttcaggacatcatgccagg

tgtaagttctatattatttaaatatcagcttcgggttaattcgcttttac

ttctgcttattatattg