RNA polymerase I polypeptide D

cDNA: Genbank AY648775

 

hi2393 is in the 1st intron

 

gtttactaaataagtgaatctaattggatttgcattgtaaacattaaata

aaagttaaaattgtattattttttttatttcatatattaaggtttttatt

gatgatactcctaaaatcataacacataaatccgcagatttttacaaaat

tcttcacagaaaaagcaaaaaatgtccgcagattctttctggccctaaca

ataccttatctggtcagaggatataaataatagacaaagaaattgataga

gaaaagggcaacataaaaaaatataacagcgattaagagatttagtagat

tatacataaaggtcgtacaaattatgtttcgagtgttttcttgttaagtc

aagaaatcttttatttttgttttgtcgccgccgaaacacgtcagcaacca

gaccacattaccgacactgcgcatgcgtggatcAACAGCAACCGCAGCAT

GGCTGAGCTTGGACAGAAACACGCGCTGGAGATGgtaaacgagttgattt

acgcattgtattattgtaatctcgtttgtattattcagtatg

approx hi2393 (3-5)

cttgaacgtgttggtgtaaaacctaaatatttgccatttttggcccaatg

aggctttttaaagttttttttttccctccagtatgctttcacttctttgt

atcagttcaaagtttcatgtatatttttaatattatcacaataatataat

tacagaaatatattctttgctaatactaagtagtgacatcatatttgcag

ccaatgactatcaaagtaagttacaactttgttctctgttaaggtttgat

gtcatacttgcatgtgatttcagaccaaatattaaaagtaccatgttaaa

caataaatagtgggcatgtcgcacgttgtgactgaacaaatgtgcgaatg

ttaatccaactttacctcgacgtagataaaacactgtcagtatatattgc

tgtatttgacacacacgaggtgtttggacagctctgggcaagctgactag

ttaaagaattctgagctttgtttcttcttctgtttagtacatcaaagaag

aaacctgtaattattgacttctattgtatttgttttacctacgttactat

ggttgtcaatgatttcagctttatatatatatatatatatatatatatat

atatatatatatatatatatatatatatatatatatatatatatatatat

atagggctgctcgattttgggaaaaatcataatcacgattattttggtca

taattgtaatcacgattattcaaaatgattatcagttgaagtcaaaatta

ttagctctcctgagaattctttttaaataaatatttcccaaattatgttt

aacagagcaaggaattttaacagtatttcctataatatttttcttctagg

cttatttgttttattttggctagaataaaagcaggtttaaatattttgaa

acccattttaaagtctataatagcccctatatattttttgattgtctgca

gaagaaactactgttatacaatgacttgccaaattaccctaattaagcct

ttgaactgcactttaatctgaatgcttgcattttgaaaaatatctagaaa

aaaattatgtacgtcatcatagcaaagataaaagaaatcagtaattagaa

ataatgagatatcaaaactattatgttcagaaataagttttaaaaaaact

tccttccattaaacagaaattggggaggaaaagggttgctaatattcagg

agggcttataattctgacttcaactgtatacatacagttattttccaccc

tgcaaaggaaagagaaataaatacaatagaataaaaatatgaaacaaact

gtgctttaagcatcttcactgtaagaaaaaaactttagctagaaaaaacc

ttcggtcaagagcagcgagggattttcttgttttgtttgattaatgataa

aaacaggcggcagcaggaatagtgcgctgtctctttaatggtttctcttt

catgtgtcttttgatcctcaactcgtttgtttattacacaaatgtgttca

gctggaaagggggcggtatatgatgcaataatcgtttatctcgattaatg

ctttttcataatcgtttgaagccaaaatcgaaatcggattttcgattaat

tcaaactaaaactctcaactagacctgtgatcaaatcttctactttcaaa

cagGTCCGGACGGATGGAGCAGATGAGGGTTGTGTAACATTTGTGCTCAA

TGAAGAGGATCACACACTTGGAAACTCCCTCAGATACATGATCATGAAGA

Ggtaagataatctatgtgttttatgtctttctgaaagccatggtaaatta

tttggacatgattcatgcttaactttgtttccttagTCAGGACGTGGAAT

TCTGTGGATACAGCATCACACACCCATCAGAAAGCAAAATCAACTTCAGG

ATACAGACGCGAGgtgtgatatctgacagttagcattttgctcaaaagca

ggcagaactaggctttaactgtctagaccagtggttctcaaactgtggta

cg