RuvB-like 2

cDNA: Genbank AY057075

 

hi2394 is in the 1st intron

 

tttgtttgggcctgagctagaaaatcaaatttaagtttttgtatcagttt

tgcttaagtagcggactagtctgatcatgtataaatatcattataaatgt

attgtataaacattattataactaggtctacatcatgctgacattcaaaa

acaaagtgacatgaagaactaaccactgatcttctatatagaaacaaaat

atatcatcagtgatgttttttctcatgtgtgatatttgatacatgaacga

agaatccagaactcatgtagacggtcacttgtttcccccggacgaATTTC

CAATGCGCACCCATTCAGATACAACCGCCTTTCGCGAGAGAACATGGCAG

CGCAGgtatgttataaataacgttttatttctgctttcttgacctatttg

ctacctgctcaggttaaacacataacacaaatgtatgcaccactactttg

tgctgtatgtatgccgttgaaatgttttgttaatgacaataa

hi2394 (5-3)

atacgtttcatatgtgagtgagctcgcttttagcacatgtgcgttaatgt

attacaacaataattccgaatacagaagtttggtattttgatgtgtgaat

ttgtgaaagttgcttttattgagaaattcggactttgggaatcctcagag

aactcttatccaacgttaacgtgaacatgaagcttgttttattgttgttc

acctaacgttatcatgtcaacgtttctgtaatatgaaattcatataacat

tacgtacatcgctttattagagcatatgccacgaattactgtattaaaac

tgtgcatcttacgttatatatttgtgctaagttaacgttacattgctaat

gttgccgttcagctaacgttagttcttctgctgtgttgaatgtgtcacta

tggcaacgcaagcgcctaacgtctattgagcggtcaaattacatataaat

aacactcacatacacaaaaacacaataaaatatgtctttataaataactt

ttaaacgaatattatatttacctgtttgttcactaatgtagGTGGCAACC

ACAAAGGTTCCGGAGGTGCGGGACATCACTCGCATTGAGAGAATCGgtaa

gaaaacacctaacgttatctatcctaaaataagttaaataaaaaaataca

aaacagcactaatgcaatgagaagatattttatttgctatatactaaatg

ggggcaacatggtggctcagtggttagcactgttgcctcacagcaagaag

gtcgctagttcgagttctggctggaccagttggcatttctgtgtggagtt

tgcatgtaaacgtgggtttcctccgggtgctccggtttccctcacagtcc

aaagacatgagctataggtatattgaataaactaaattagacatatagtg

tatgtgtgtgaatgagtgcgtatggatgtttctacc