WD repeat domain 75

cDNA: Genbank BC045446

 

hi2404 is in the 1st intron

 

tcgacggcgacgagtcgaaattctaaaatacatggcgctgcgcggcgcgc

cgccgagcggcgcttctggtgtgcgacctgctatactttaatctgtcatg

tacgcgccgtgtcgcggcgccgagcggcgcttctggtgtgcgacctgctt

aagtgttcgcccggtcgcgtgatgtcGCTGTGCTCCTGCAGACACTAGTC

ACTACAGACGAGGAAGAGAGACGCGTTGCGGCCACATGTGATGATGTGAA

TCTGTAGAGAGGCTGAAAACATGGTGGAAAAGACTGACATCCGCGTGGTT

CGCTGCGGCGGGAGTAAAATAAACTTTAGACCTCCTATCATCTCGCATGA

CTCCAGgtatcctctaaatctagtcaactaacgtgtctgattgtgtctgc

gtattctctgcggtcagaaaataaacaccgggccgtgcaggagggaatgc

agcgtgatgagcgaatcacactctgatataactaacagttacttgtgctt

ctaaacttgtatgaatgaaaagttcatctgcttttttaatgttgtgaggg

ttggtgatgatttaaacatgtttctagaaggcatgtcactctttcagaca

cacatcatatgtattggtttagaagaaatgtctttcataatagaggcagg

tattatagaagtttattgcttttaaatttactttagcgttaaattgttaa

actttaaggacattcaaataatacgatctctttaaaagatggccttccta

aaataaaatatggctgactttattagtatgcaggaaaaacggattcatat

tgttttatttgaagcaaacatgttaacagtcctccaaaaagttgtaattg

atttat

hi2404 (3-5)

tgttgattgttattacagtatttttgagatgctgttattttttgtgtgaa

tttaacaccataaacagtgctcagtataattgagtacagccatttttaaa

aatgaatatttttattaattttcagtgaatataggctacttaatctggtg

catttaaacaaaacagatttatttaacggatatatttgttaaaataatat

tttagtcaccaaacatttagaaattgaaagataatacaattaaattcaag

caaaatattacaaaaacaaattgcaacctacaacatttcaacaaaatttt

tcctttttatttatttattgttacttttttgcttctcttggtttttcctc

ttctttaaatttgtctttattatttttctataaaatttaaatttggcttt

actagtttttgcaccattatcgcaagttattttgttagataagctccaga

tttgtctgcaatactgactaatctaaagtatatgctcaaatacaatattg

tttagctttctattaaaaatatgaagttaaaagattgatttgtgactgag

gggtgtacttgtatatgctgaccactgtatacatacatagatttgtgtgg

ggtgtaattatatatgctaaaaaaaaagttattttgagttttccaaaaga

aaatatataacttacatacagatcttgcatatgctttgtattttcttccc

tttaataacaactataaacagtaaaacatggggtgctacaaatgctttag

aagattgtcttctaaagatgaaaatatatgtatattctgacacataatat

taaatttataagttataattcaagaaaagcatattggtgaaatatactca

atttacttcaatttagaaaaaaagtaatcaatctgtgttcttaataaaaa

agatgtcatgcataaagtgttcagtgtatcaatccattcttcaactgtag

gtgactctaattttaaccatttgtttgtaattacttttttactagctgcc

ggaagaagaaaaaaagtttcttgtctttattaatcaacccatctaaaata

atgttgcctaaatataaagattcacaagtgaaagcaatctctacttaaaa

aatggccgaatttaaaactatattgattaattgatgcaaatacatggtgt

ttgtagtaaatgtataataatatttattaatattattagtaaaagactta

aaataggctgccaagattataataaactcatgattttagtggtaaaagta

aaaagtagtaatgaagtatgtaaaatgcttggtacatttggttaatactg

caaaataattgtgttattgattgaaaatacatgcatcagttctgtgaaat

atcacttgtaaaaagtcaaatctgtatgtctaatataaaccgtaaacttt

gatttgtaaaatgttaacttatttaaataatatgcatcatttattaagtt

atgtcaccatttattagtattttataaaatttgaagatgtgtttatcact

atttattgcctgaagaaatgtgaaataacattttaattttaaccaacatt

aacaaagatgaataagtgctgtaatatattgaaatcgctaatttatgcta

gctattctattatagaatgattataacagcttaaaacctgtaagcagtta

ctaacatttaattctaaatattaatcaacaactaaatttatcagtttagt

ttgcagtaagtgtttgtgcattaaaagtgtgcatacgtatgaactcgctg

cacaagaagtttctagtgtcattgtaaaggcattgactaaagttgtgtgt

ctggttgttgcagGTTTGTGTTGTGCGTCTCTGGGGATTCAGTGAAGGTC

TATAGCACACGTACAGAAGAGTGGCTTCATAATCTGCAGGGCCACAACAA

CCAAGTAACCGGCATCGCCTTCAATCCAGCCAATCAGCTGCAGGTCTgtt

catctctctgcttctggtgcataaatgtgtgagacagttgattgggtttc

tttgttcattcagcattcagatcagcttgtttgtaagtgttctttaaagt

cagcattacaattcctgatgttatgcgaggattggggctgttatgtttta

aaagaagtct