40S ribosomal protein S15

cDNA: Genbank AY561511

 

hi2430 is at the splice donor of the 2nd exon

 

CTTTTCCGGTAGTCTCTGAAGATGgtaggttcatgtctttatttctgaat

agctacatcacattaatccaaagcaatctgtcgtatatacaatgcgaatc

agaacattaaacacgagtgagatgtgtttaagatttagtgaatgttacca

ggccactatttaagtgtttgggatgaaagattaggtagatgttcgtctga

ttagcagcttcagtcttgcgctgcatttctcagtccggcatgatggatcc

acgggaatttttaatacgttatttttgagtggcgttatgaagcaccgcgt

tttaacgtatttagtcgtttatttgttattgaagtcacggagagagtcgc

ggtaatgtctcccagcagcggctaacagtggttgtgtttcccgcagGCGG

ACACTGAGCAGAAGAAGAAGCGTACCTTCAGGAAATTCACCTACAGAGGT

GTGGACCTGGACCAGCTGCTGGACATGTCCTAg

hi2340 (3-5)

taagtaaaaattaaaaacattttcgctccacactgttagtaaagacaaag

ctttatgtaaactttttttttaactatcgtagtctgatgtgatgcatttc

aaagtatacttgttcgacgcatgcgcaataggtcatatcgtgggacattt

cattcctaaatgtttagcgatcatatcttaaggtattgccaagccatgta

acgttagacatgtaaaattatcgtcctgctgattaactaactgctgcaaa

atgtgaaaagtattcctttcataatttgttcaccttcaaatttattccaa

agttttgagcttgttttaaagagtgttcgagtgttttcacacctgcctca

tgtagtccgattaaatggcactaaagttcattttcccttttggtgtggtt

cgtttgggcaggtgtcagtgtagcaatcgtactgtagtaagcaccaaaag

cataccaagatct