60S ribosomal protein L3

cDNA: Genbank AY561514

 

hi2437 is in the 2nd intron

 

gtttcgtgttcaacagaataaataaactcctaaaaaagtgatatcatgtg

gttgagtaaatagttttaagtgagcaatccctttaactccccttcatgtg

ttactgattctgcttgcaaactgttttagatagtcacgtacaccgtccga

taatgatagtaataaacatcaagattaaaataatttaaaaactattgaga

ttttttacacactttcaacatacttcagccacgtgtggagtccaattcat

tactactctcccatagagggcgacgccgccactggaggatcataacgtct

gtgcgaaagacacaagttgtgacGCATACACGTCGAACGTGCTTCCAGCT

TTATAAGGAAGCGCCGCATTCCTTTCGCCCTCTTTTAATCGGACAGGAGA

CGAAATGgtgagtgtgcggcttttacttacaacccgatcaaaatcaaacg

catcgtactttttacagatacatcccagtttgtgttgtatttattaaagc

cagataagcgttttattatgtttattgcaggttgtaagagggttttacgc

atggcgcacgggttttcggctgtatgaggaaatggcaacattcttgtcta

aattaggcttaaaaacaagtatacacgactgaaggttttgttaatctcaa

aactgaaatctaagattgttacttaaataataaagaattttttttgtaag

tgtttgttatggccacggtctccacacgttgtgcggcagccggcgagtca

ggcctcggttttattagccagaagttaaagtaaccgtgtcttttatatat

gtatttttgtatttaacgttctcatggtaattttaaagtcatatatgcga

tacagttttgtgtacaatggttttttttttctgagtgaagttgtgaattg

caataacggtaaataaggttttttaagttaaggaatgttttgagttttaa

cgttagttcaatttgttaaatatatatttgcagtaaaatctcaaaataaa

cttaacagaaattaactctattgaaaccttacaagaatttatgctttcca

aatcgacaaaccacagagttacagggtcagaaaatgttaaatttgtgagt

ttttaaatgttatttaaatgaggaaattaaacgtgttataggcgattaaa

aaacgttacaacatactttgtagaaattctgctaattgcacaacccaaaa

taatgctaaaggatgggtctgcgcactatagaagaaacaattaattttag

ttgacttaatgcattcatgaggataaagctatgcagttatggagatgaca

ccattatggatgtgaagaatgtgaaattggcacttttgctttattttggt

aaaacaaatataaatattttaaaacattaacaaatattgagttttttttc

ttttactacgtactgtaaaatacatgcttgcaaaaacttttttacatgtt

ttttttttttttttttttttggcaaggttaacatttgcatgcatctcatt

cactcctttgtgaagcattataatttatttacatttccctcttttagTCT

CACCGTAAATTTTCGGCCCCACGCCACGGCTCTCTGGGTTTCCTGCCCCG

CAAGAGGTGCAAACGCCATCGTGGCAAGGTGAAGAGTTTCCCCAAAGATG

ATCCCAGCAAGCCTGTTCACCTGACTGCTTTCCTTGGCTACAAGGCTGGC

ATGACCCACATAGTCCGTGAGGTCGACAGACCTGGCTCAAgtgagtgacc

ccttcagttcttgcat

hi2437 (5-3)

gctgaaattttatgtctgccattgatgatactctcgacgggcggacatat

ttgggccatgagcccttgctgaatgtcgagtactgagagcagttgcataa

ctttaaaaatatctttgatcagtctggttgtataaaactttttttttatt

gcagaatttaaagttttgtttttttaaacccattcagAGGTCAACAAAAA

GGAGGTGGTGGAGGCAGTGACCGTTGTGGAGACTCCTCCCATGATTGTGG

TGGGTGTTGTTGGATACGTCATGACCCCTCGTGGTCTGCGCTCATTCAAG

ACCATCTTTGCTGAGCACATCAGTGATGAGTGCAAGCGTCGCTTCTACAA

GAACTGgtaagttaaacaacttctggtcgcagtgcatgcatatttagtct

ggagctggtggtagctggccagattaaacaatgttgtttttttctgagcc

agtctaatttgtcggtatggtgcagctccgctcaggtgcctcgtgccctg

atgagctccgggctccgctggccggtggaaagggctccttagaaaccgtg

ccatgagccaaaatgacctagtgctgtcgatgcctcccctttttttatga

ggatgggcaagcagccgtgcccagtctccttccactggcccactgggcta

tgaaggaactgcgtgccaacctct