RNA terminal phosphate cyclase-like 1

cDNA: Genbank AY648776

 

hi2452 is in the 1st intron

 

tcgacacagaggaagatttacacctcactgctaactagcgtttcagaagt

gttaatgcagaccaacagagacagcagcagaagtataaatgcacagccac

gcgcgttgcctgcgccatgggttacgccggtcacctgacgcagaagtata

aatcaggcttaatacgcacgcacactggattaactatagcagcaggtcgt

tcacatatcgtgtcttttctgagcgcaactttgttatttctaaggtaaga

ataaatagtgaagattattgagatttgatatcttgattatatttgtttat

agaagctattaattgtaataagctgaactgtttgctaatttgtttgctgc

taatgtatactattatttactaataataataaataatgctaaaacatatt

actgatcacttaactgcttatttacaatgaaacagcgtcaatagaaaaca

aaaagatgctttaatgtgttgtatgttttatagcgtgtagaattaatact

tattaatccaagtaatttactgtagtatggttaaaaacataatactattt

gctagaaattgacattatgtgttcattaatattttattttgtgtagaaca

gatttttatcaggtttttaatgtttatttttggctgatctggctctttaa

ttgaacaatttggaatgtttatattgagtttgttgacctcttgtggctaa

tatgatgtagcgtcttcttttctgcttcgcgttttgcgttttgtccctcg

cgctctgccgtcacgcgtcggtgtggcgtctgtatcgcagtagaaacacg

tgtgtgagagagtgtgtgtgtgtgtgtaaATGCGAGTGAGTGGATTTTTC

TTTTAATCATGGAGTTTGAAGGTTGTAGCGGTTTTAGACAGAGACTCGTG

CTGTCCACGTTAAGCGGAAAACCAGTGAAGATACGAAACATCAGATCCAA

AGACGACAATCCAGGACTGAGAGgtgcgtcacaaacacacacggatacac

aaacacacactctctctctgtcaacaatccataacactcatctgtacttt

aaatatatatat

hi2452 (5-3)

caggacaacaacagagatctaaagatgttaatgttttataaatgttttat

atatttaattaaatgttttatatatttaattaaatgtttatttctgcact

ccataagtctgcagttca

 

 

approx 5 kb to next exon