ATP-binding cassette, sub-family E (OABP), member 1

cDNA: Genbank BC045882

 

hi2453 is in the 5' UTR

 

gactggcgcgttttgatcacgtcagaggtttcggtcgcgcccctttagcg

tcctgcgctctggcgccATCTTTGCTACCGGTGTTGTCTCGTGCGCGCCG

GAGCAGCACGCGCTGTTCGTTTCTTCATA

hi2453 (3-5)

CAGAAAGACGACATTAACGCTTATTAACGCGTTATACTGCGCTGTTCCCA

TCAGCGGGAGgtgagcagtgttttattgccattttgtgaaacttaagaga

aaattctaagatatttggacagagaattggagcgtcagctgtgtgcgtgt

gccgccctgcgcgcgaggccttttagtttcaatcagatatcgttgttttc

cactaatactcaatgaaagtcattctgatcga

 

approx 4 kb to next (1st coding) exon