clathrin, heavy polypeptide (Hc)

cDNA: Genbank AY648777

 

hi2462 is upstream of the gene

 

cctttccgtgaaccctgtagtttccatgtgataaggatcttggttaggtt

tcaagagatgcattttagctttcagacgacggtgctccgcattttcctac

caaaatgcgataccaataataccaaaacacaaaagtacttgaagtaccgt

accgatgaaagcattgaaacgcccctgcatataatatacaaataaaacat

gagaaattaaatcggaactgacgtcaattcacgaggacgaatgatgtggc

aaaaagcaaagggcgattcgcaaagaaatagtacccacacatttacgctt

aaacgtagcttaataacacctcc

hi (3-5)

catctttcaaaataatcacaaaacagatacaatatccataaatgtatttt

gatttctaaagtggtgacatttattgtcaaacaaactaaaatccatattc

ctcgcggtgctcatattcctccgcctccattgaggtctacgtctctttcc

ggtgcgtttctccaccggacgggttccgccgccattgcaggtttctagag

TTCCTCTCAGCGGCGGTTGACATTCTGGAGTTGAAGCGCCTCATTTATAT

TCAACGGGCGACTAGAGAAACCTAACACATTCCCGGTTCATCTGCCCCCT

CCCCAAAAAAACACCAGACCACCTCCATTCATCCCCGGCTCTGGAGTAGT

TTAGATAAGGCAGAACTAATAGCAGGAATTAGAGAGCAAATCGAAGAGGA

ACCACCACCACCATCATGGCTCAAATCCTGCCCATCAGATTCCAGGAGCA

CCTGCAGgtaaggactcaaaaacacctaattttgacgcctcggtcatttt

attgttagtttaaagtgatgaattgtaatacaccgctttagtaagtcatt

ccccgatgaatatgaatggagctgtagtagtagtagcaggggagttagct

tagctaacgtttgtcggtggtaaccagctgaataataaatataacacgtt

aatgttactggttgtctcgttgaaaa