eukaryotic translation initiation factor 3, subunit 6a

cDNA: Genbank AY648778

 

hi2470 is in the 1st intron

 

gggccccccgcgtggtcgacggcgacgagttgagcgctgcattgtaaata

aagttttccggttttgaagcgcgtccTTTTCCGTTGCCATCATGGCGGAG

TACGATCTGACCACCAAAATCGCCCACTTTCTGGACAGGCATCTCGTTTT

CCCACTGCTGGAATTCCTTTCAGTTAAAGAGgtacgtgtgtaatttacgt

tgctgtttgaaactgtgctatagcgctttttgtttgttcaaagagactca

tttatgaccacgtgcgcgcggtacgggagtcgcaatggtgatgccgcacc

ggtaacttcagtgtttaaatggtataatcacgatttaagcagttaaaata

acaaacaagtgcttacagacacaacaaactgaatacgagtcacattcatc

acgaatagattataacaaactcgtatttcagttgttggttaacgttagtt

atttgtgagttgtgggctaaaaagctagcaagctgcctacctagcactgc

aagcttcgagagagactgtttaagggcacct

hi2470 (3-5)

aaccgactgtaatgccactttggcttggcttgtcactctttagcatgctc

tgcggttgtttactactctcgcatgctgtctgttgtacgtaattgaacgt

cgtaagtttgattttgtggtattttgttcatcgagtgttgacagctaact

ccagctagcactgatgatgttttgttgaaaatgaaagcactctaacattc

gaagctattgtttcagaaaaatgtacgtttgtgaagatacagtgttactt

taaagctatcacagttccttaaatgttatattgaccaaaataacatataa

gttgcagcctaaaacattattgcatttaatgaaacgaaataaagtgaact

tttatacacacaaacggataaaagacaaaaaagacttttcactacaataa

tatgtgttctgcttaaccgaaaagatcgatcatttacaaaagacattcac

caaagagctatttgcgtaaaatgcatatgtaaaccaagattttttatgat

ctctatcatttaacttttactgtgttgttatagagaaaacattttccaaa

tcttggatcttattcttgaaaggaaaaatgaccaataaaaagcaccaaaa

gcggcacatattaatactaattaggctgttgttgttatccataaattttc

aaagtattttttttacaggagaagctaaaaaaatgtgactgcccggcatt

gttgttattactattattatgtttgtttatttatttttattattcaaaag

ggcaaattctgtgactgaggaaagtttaatgtgttggccagtttgttatt

tgcctaataaattacaatgggctattacaatttcccccagtgatatatca

taaagtagcctctttatacttctttattttaaatctttagaaattttttt

tggtacataaaaaagtgagaccatccgacaagctcattcagcaaaaaata

tgcttaaaatctcactaaatgcagtatttaaacctcataattaaatagaa

aatgaggtaaataactgcaaaaatgtccactttttgagaaaaaaagaacc

agcacgggcctgcatgtacagttgaagtcagaattattagccccccctgt

ttatttttccccaatttttgtttaacgaagagcagatttttttttcaaca

tttctaaacataatagttttaataactcatttattttaactttgccatga

tgacagtaaataatattttaccagatatttttcaagagacttctatacag

cttaaagtgcatttaaaggcttaactaggttaattaggttacctaggcat

gttaggatagttaggcaggttattgtttaatggtggtttgttctgtagaa

aaaagagttctgtaataattgttctgtagctagaaaaagatatagcttaa

aggggctagtaattttgaccttaaaatgtttttttaaaaataaaaactgc

ttttattctagctgaaatcaaacaaaggggggctaatagttctgaccgta

attgtatatgtatttttaaaagtacaggtcagattaaaaagatagtccac

caaaaaatacaaatttactcacaaccacatggttccaaacctctgagtta

tttttttttatttctgttgaacacaaactatataatatataaaataataa

taattatattttaggaaaaaataccatagatgtcaatagttactagtttc

caacatttattcagaagaagctaaaacaggtttgtgacaagtaaaattat

gttaatgatgacagaattttcatttttgggtcccgcaatgcgtttaattt

tctctcacactgacacacacacacacacacacacacacacacacacacac

acacacacacacacacacacacgcacatctgagaagacaaacaggtgttg

atcaatttttcctgccagtcaaaacctacaagtagaaaaagtcaaatatt

tttgataaacttattaaagtattctcatattcttcgtgaatgtgcttatc

ttgtttctattatcattttctagATCTACAATGAGCACGAGCTCCTCCAT

GGAAAGCTGGATCTCCTCAGTGACACCAACATGGTGGACTTTGCCATGGA

TGTATACAGGAATTTATTTCCTGACAAAGAAATACCCAACTgtaagtgtt

tttacttttaattgaagcttaatgtgatatgactatgagattgttataat

tattacttatttatatgtcttct