heat shock protein 9B

cDNA: Genbank BC044175

 

hi2473 is in the 1st exon

hi3366 is in the 1st intron

 

tcgaattagcgaccttcttgctctgaagcaaacttgctacccactgtgcc

accgtgtcgcctaattgaatcatattgttattattaacagtaacatgcta

agattcattattacaatagtgataaaaatatttactataagaagtgggac

acattacacttagacaaaaggggcacccctcacactttcaactgaataga

cctactgattgatacatagcgtaataactgtaacgttatattctatcccc

ttcccctacccgtatactaaactctgacaggaaacaatctgcatttttac

atttttaaaatacttatttactttatgtgtgatttatgagcattcgtgat

atatgctgacatattttagtccccactgggatataaaaacatgtacacag

acacatgcacacacactaaattcattgctcgctctatatatacgtgctcc

agtgtaccattattatcacataacaacttctttgtttgtaagttatatta

ataacggtctgcaaactggtgcagtaatccttagtctcttgaaggaaacg

aatgaataaaggcttggatccttgcagttttttcttaataccgcatttat

tttcgtttgtagttatgagcgtgatgcatgatgtaagaactacgaaatat

tatagtttgaccttcaagattgcagccgttggcgtccacatatatgcctt

gtgtattttttcatttaatgattatttacatttatattttctctcagtta

acatacttttggggaaaaaatgccatataacacaaaatgaataattgttt

taagcataagtagcattctagtttgagactgcatgttgtattctgttcag

gcatttgttgacactctatggggtccttctgatcgccatgtggtgttgga

taattctagaagagcgcaagcgagagttcATCGCACTGGTTCTATAGGAG

CAGGGTTTGATCCATTACAGAACATTTATTTGACTTTCGTCTGACGAAAA

AAAACTAACCAAAGACTTTTTATCAACGTTCACTTAACAAATAAATAAGT

CAAATATGTTGTCTGTGTCAAGAACGGCAAGGTTAGTGAGAAAT

hi2473 (5-3)

GTGTCGTGCTCTCAGAAAACCTCCAGCGGTGTGTCAGATCTCATCAAAAA

Ggtaaattctgcaataatattacgagctgtcacattgattcttaagtaga

ttttttcagctagacatatgtttatcaacacgacatgaccgatgtgctgt

tattgtattctagtaaagtaggtatggtaatgtgatctgctgaattagta

tttatgacatttggcttaaaatagttacaaattattacaaatttgcttaa

gacatgtacgttctataaaaagtcgaagttactaaactgtggataaaggt

ctatattgtcctatggtttgttacgtttgaaaggcccatgcgtccatgcc

gttagcttgctttgtaagaacgttactaaagacagtgttacttaaactcc

attttaaggggcgttg

 

later in in the same intron

 

tggtcaatcaggttttagaggggttttggccatttccaggctggtttcca

gccatttccagcctggtctggtcttaactagtcaggctggaagatgacca

gctaaaaccagcttgactagcttaaaccatggccaaaaaaaaaaatccct

ctaaaaccaggatggtcaaccatctaaaaccagcctagcttggtttgagc

tggatttttttcagcaggataatataaatacacacacatacacacacagt

agttgaggtcagaattataataattagccctcctttttatgataattt

hi3366 (3-5)

gcacatcattattatccctccagaaagtctgttttgtttcggcttggata

aatgcaattaaaaaaaatttaaggtgaaaattattagcccctttaagcta

atttaattttttgatagtctacaaaacaaaccactgttatacaataactt

gcctaattaccctatcctgccaaggtaacctaattaacctagttaagctt

ttaaatgtcaatttaagctgtatagaagtgtctcttctcccaattaaaca

gaatttagggaaaaataaactaataattctgacttcaactatattattat

tattattgttattattatatatgtagaaatatatatattactatctgttc

attttcagGCTTGTCTAAATGGATGGACACAGAAAACTCTCCAGACTGCA

GCCAGGCGTCATTATGCgtgtgtatataatctatctttaaaaaaaaacca

aaaaaaaaacaagtcaattgtcaatgaatgattgtcttatgcttctgggt

gcatttttcagGTCAGAGGCTATCAGAGGAGCTGTCATTGGCATCGACTT

GGGAACCACAAACTCCTGCGTGGCTGTGATGGATGGAAAAAATGCAAAGg

taagcaattgtaatccaatggaataggaaaaaatgtctgtttaaggtcac

cctatacttgtttgaaacctgtaaaagttaaagaaattgacatcttgata

atttaaccaatagttaccacgtagtgtatattttgtcttactgtgtactt

gcagtatttgtttacccatcaatatttggctggctgtagatgagtccaaa

gagtttctacttaaaagctatcatcaaacagcacgagcatcaccatacat

aaagaatttgcttctgtgttcgcacatccttcttagttacctgactagac