wee1a

cDNA: Genbank AY648779

 

hi2479 is in the first coding exon

 

agaaatgttcatctaaaacaaagttacatcatatctgcttgatttgtcag

CCTACTGGGCTGGTTTTAATGCCTATATACAACTTACTTTTAAGTTTTTA

CGTTTTATAGTTAAAAATAGCTGAACTTTTAACCGAAAATATGAGTTTCG

GGGCTGGGAGACACGGCAAGTCTCCAAATCTTAAACCCGTTCGCCAGAAG

CTGCAGTTTTCGACTAGTGACGGGGAAGAGGACAGCATTGAAGACGCAAA

CAACAGCACTGGGGCCGAATCGGGTTTCACGGAGCTGGACTCTCCAGTAC

CTTTGCGGCGCAGCCTAGAAAAGAGGCCGGAGGACTTGGGCAACAGTAGC

CCGCTAAGCCGAAACCGAGACGACGACGAGTCCTGGGATGAAGAGGGGTT

CGGCTCGCCGTCTCGGGTGAAACCAGCTTTTTACATGAAAAGCTCTCCAT

CGCCACGGAAAAGTCCTCCGGCGTACGATAGTTCACCCGAGAGGAGTTAC

ATTCACGATGACATGG

hi2479 (5-3)

AAGGCTCCAGCTCGCCTATCCCGGACTGTCCCGATACACCACCCCACAAA

ACCTTCAGAAAACTCCGTCTTTTTGATACCCCCCACACCCCAAAGgtttg

ttttttcagttattcgcaaaaatagtttgtgcgttttatgtacaagttta

aaagtttacatttttttgtttacatttgtaaaaaatgtttttccacgagt

tttttttt