general transcription factor IIIAa

cDNA: Genbank AY648780

 

hi2487 is in the 1st intron

 

ccacactatatatacatcttattttatgtattttgtcatatatataaaca

cgtggtaaagtaccatttgcgttttgtgcacgctttaaaattttggcctc

aatggctttccatACAGTGTTGTCGCATGCTTTGACGTCAGAGTTTACGT

CGGCAATCAAAATGAAGGAGCGCACGAGGGACCTAAATTTATACCGCTAT

TTCTGAACATATGACAATGGATGAAACTAATGCCAATGTTGATCAACTGG

GCGAAATATTTATCTGTTCCTATCCGGAATGTCACGCGTATTACAACCGA

GAGTGGAAGCTACAAGCGCATCTCTGCAAACACACCGGAGAGgtcagtta

acacacacacatgtgctcgaagattggggatgagtgtcatattagctgct

aatgactatcaaagtacaacattgttcacagtttaaatagtgctaatgtt

gttttgaagccatattacatgtgattttacatcagatattcaaattagca

agaataaaatgaaataacggtgcgaatgtgtacctcagtattcctgtaat

aattgagatgaagctggtttcatattcgggctttcttcttaataatataa

tttcagtaaagttacttattctta

hi2487 (3-5)

gtaaattctaaaaagggaaaacatattagcatgcaataactatcaacgta

caacatgcacgcaccggccactttattaggtacatcgtacaagaccccct

tttgccttcagaactgccttaatgctaacaaggtactggaaattttgtct

catagatttgtctccatattgacatagcttcacgcagttgctgcagattt

gttgactgtacatctataatgcgaatctcccgttccaccacatcccaaag

gtgctcttttggaatgagatctgatgactgtggaggccatttgagtacag

tgaactcattgtcatgttccagaaaccagtctcagatgattcacgcttta

tgacatggtgcgttatcctgctgaaagtagccatcagaagatgagtacac

tgtggtcataatggaatgaacatggtcagcaacaatactcaagtaggctg

tggcgttgacatggtaaaataccaaatttactcaattgcccaaatgctca

attggtgctaattggcccaaagtgtgccaagaaaatgtcctccacatcat

tacaccaccaccaccagcctaaaccgttgatacaaggcaggatggatcca

tgctttcatgttgttgacaccaaattctgacccgaccatccgaatgtcat

agtaaaaacggatactcatcagagcaggcaacatttctccaaccttctct

tgtccagttttggtaagcctgtgtgaattgtagcctcagtttcctgttct

tagcagacaggagcggcacccggtgtggtcttgtgctgctgtagcccatc

tgcctcaaggttgaatgtgttgtgtgttcagagattctcttcagcagacc

tcagttgtcacgagtagttatttgagttactgttgcctttctatcagctg

gaaccagtctggccattctcctctgacctccgacatcaaaaatgcatttg

tgtcacagaactgtcgctcactggatattttctctttttctgaccattct

ctgtaaaccctagagatggttgtgcgtgaaaatcccagtagatcagcagt

ttctgaaatactcagaccagcctgtctggcaccaacaaccaggccatgct

caaagtcacataaatcacctttcttccccattctgatgctcggttgaact

gcagtagatcgtctagaccgagtctacatgcgtaaatgcactgagttgct

gccatgtgattggctgattggaaatatgcgttaacgagcagttggacagg

tgtacctaataaagtggccggtgagtgtatgtcagggttgaagcaaagat

cacttgtcaacattttacctgttctcttgcagAGGCCGTATAAATGCAAG

TATAAGAAGTGCAGCAAATCTTTCTGTACGAAACATCACCTCAcTCGTCA

TGTTCTGACGCACACCGGtGAAAAACCATACAGgtgagtagatactatag

tgt