TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor

cDNA: Genbank AY648781

 

hi2491 is in the 2nd intron

 

ccaggcaggaactcggcgcgggagggcagagcaaagcaacaacatggcta

AAGATTTGGGGCGAGAATTGTTTTGTTGGTAATTTCATAATAGAAAAAAC

TGAAGAGTGTCGGTACATGTTATAACAACACTTAAACAAATAAGGACATG

ACGAAATGGACTTAAGgtatttttgagccagaagaaaattgtttttagtt

tttttaaaacatattcaaccaaaacactggttttgtttttcccagGGTTT

AAGTGAATAAACCGAAGAAAGAATGAACGCAAGAAAGACAAGGGCTTTGA

GAGCCCACGACCATATAAACTataagtatcaaatacgttttgtctctcac

tgaatt

hi2491 (3-5)

gactaacgtaacgtttacgttaatcacagttgtgtttacattgcacatga

gaattaattctgatgatcgctatttacgttactctttgtttatctctata

cGACCCATCAGGTTGTCTGCATCAACAATGTAAATTTTCAGAGGAAGTCT

GTCATTgtgagtatgcaatttccatttcttcgtgaacgttatgtgaatga

agcagaaaatattaagggactttgtatgcagtctattaaaaatttaaaca

gcgaggcatgatgtatgtggaaaatttgcaatacgtcttaacagcatttt

tattaagaacagatttaaattgacgttcatggtttcatgatccagtaatc

acatgcatttatagccattaattaagctaattttgtatagttgtaaaatg

tcagattgtaatgttatgctgtcttgttatagaggtaaagttgattttat

attcgcacatttattcattcagtagtccctatcga