extra spindle poles like 1

cDNA: Genbank BI892436 & EE717933 (incomplete)

 

hi2497a is in an intron

 

ctatttagCAATCTGTTGCTGGCCTGTTGGAAGAAATGGATGGAGTCTTG

AAAGGACAAAAGGAAGTGAGCACAGTGGCTGAGAAATCACAGTGGTGGGA

CGGAAGGAAGGCTTTAGATGCCCGTGTGGAGgtaaacatctttgactatt

cgaaaattattaacgggattgtttagtcaaatttactctcatagcctctc

atactgtgtcctaaatacatgtgacgctgcaataaaatgtgtcttttttt

ttttttttttttttaaatcacggcagtgttacagaaagtttatatttatg

aaacggctaaaacaacagcctaaactactaatgacaactactatcgcctc

aggtgctgattatgtgctttatttgtgtcaaatgataccagtatgagtgt

gaattacatttgacatgacatttattgccataatgatgcaccagcagata

cttttttaaactagcaaacatagcttaaacatgagttttagtttagttta

aagctttataaatccccttggggcaattattctttcatggtggtgctata

acaagaataacacacttaacacaatataaacaccaacacttaacaacaag

tatgcaagcaaaatagaaaaaaataaaatgattttgcgtcttcggctgca

tttacactgcagggttcaagtggctcgatttagattcttttctcccatga

ggcacagatcggatatagcacatacgtctaagcaggaaaaaatcttttgg

attccgatttactcaaatcagtttcaggccttgttcatgtgtggatgaac

atatgaattggatctgtgtctgcagtttaagcaggtagattagattttca

acttccaatgcaagtcgagcattgttaaaaatcctagggaatgacgtcaa

gtctgatgcttttatttcggaaaagagttgagcagagtcccaaacctaaa

tctcacacggaacgaaaaagttttatgttgtcatgtagcacaagtatgta

cgcatgattaactagagagagagagagagagagagagagagagagagaga

gagagagtacaatatccaccacgtaaccaatataaattaattaatataaa

gctgttgcatacatcaggtgcataaatcacaccatggacattacattaga

atgcctattggtttaaaaaggcctagattaaaagaagatactagaagaaa

ctatagtaaaacaactggtcaaaaagaataaaaaaaaaaaatgtaaaccc

tgggaacacaataaatacaggaatggagaaaagatagctcttatattatc

agctgtcagtcagctcctgctcttttttttattcctggtccttgcacctt

tgccgtgtgctgtgtgaatgcagacaatcgggcaagagttacttttaaaa

gatgatgtaagttggtcaacaacaaaaaaaatcggatacattcacaaaat

cgaaattgactatcaagatctgcagtgtaaatgcagtcttttactcagtc

caaaccaacaaccaactaatcagtcagtcagcatgtactttgagtaatgt

taaagaagtttgatatttattaaagagccatgaaacccccctttttcagc

ggaagtcttcttcagaagtttttcaaaaaaatgatctgagatgggtgtgg

agcagcgctgtaagcagagggttgagtaggcgtggccgacagtgcagggg

aaaaagagtggagcgattcgagagaactgtcagttggctcacaaactgtg

agaaggttgattttatagtttacaaagttaaaatgtaaagaaattaacag

taagtaatgtaatgccctgctacatttgtcattcataatttcatttacac

ataaccataaattgtactatcattataaagataatcgttgttgtataaac

actttaaatgaggaggacttctctcctcctcaatccttgagtttaaatgc

agacagtggatagcaatgcagtctcttgccctgtctaatccaaccattag

ctctgcctgtaatctggagaattttaaacgtgtgcgaacacagcagcacg

gataaaggcgatgtgtctctatgctaacctgatggtaacaaactccactg

ataaaagacaaagtc

hi2497a (3-5)

cgccactctccaattctcgcactgctctcctgacaaaaatgcttgctgca

aaaccaacagctttgctgtatcagcccggacagcatcacggggaaaaaca

tgcattaaaccccatggatcatggaaacaaacacatacgacccgtgtctc

atccagtcactgggtctcccagcttggcaggtctgctttgtcttcggaaa

gcatgcactcatgaataattaagaagcagggtcttctcatagaataagaa

aactcgctatgagtaataatgagaaaccgaagcgccatcacttcacttgc

agttttgcgctacgtcaccgattttgatcccgccccaaattgattttaaa

cccagaagctgaaattagctgacaaaagctcaaaaggatccagttttacc

cacaattaaagttgactggtgctaacgctgtcttaactgatgctcagcac

acagtgtactgtagtgcactaatctgctcttctgaatgactgtatttaaa

tgtttctgtcgtgtcatgtatgttgcagacagccaaattgtttgtcgctg

gaattgtcacatcgcattttgttaggacactgtgtcaaatggtttcatcc

cttgtagttttcttttatttctgataagctcaaaggaagatattttaaag

aatattgggaactggtaaccattggcgtctatatttgtttttcctgctat

agaaatcaatagttactagctgccaaaaacaagggttgcttgaatttgaa

aaaataattgggccagttataattcctttaaactgaagcaaactggatgt

actaaatgtcatctttatccatcagAAAATGCTGGAGGAGATGGAAGAGG

CTTTAGGAGTGTGGCGAACTCTTCTTCTGCCTTTGACCTCTGATCCTAAG

CTTGATGTACAGGTAAAGAGCCTCCAAAAGGCTCTTAAATCAACAAAGAT

CACACAGGATACTCTCAAGgtgcttcacaacatccatttagcttgattaa

atgtttctatctgtagccccatctcaatcctgctttctgtttgaagGTGA

TTCTTTCAGCCTCTCCACTGCTGTCCCTGCCAGACCTGCAGTGTCTTCTG

GAAGGAATGAATGTGCAGGACAAGGACCTGCTGAAGCTCCTTCAGAGAGG

CGTGGCTGAACTGAGAGGGAGGGAGGAGCCACAGGGACACACTGTTGTGA

TTTTAGACAAGgtagactcctcagtcttctttcagctgattcaatatgga

ggttttgatctaaccgcagtgtttatgtttgtgcagTACTTGCAGAGGTT

GCCGTGGGAGAACATTGCTTGTCTGAAGTCTCAGTCGGTCACTCGAATGC

CCTCATTACATGCGGTGCTTGGACACAGTCATCTGAGAGAGgtatatgct

actctgtgcaaataaaaatgtaatctttggtagacattagcccctt