vacuolar protein sorting protein 18

cDNA: Genbank AF506204

 

hi2499a is in the 4th exon

 

aggtaatttattggagctatttctgtagaagattcgattgttaactaaac

agcgccaatacgtggacaaaacaggagcatctttttaactgtaatcacat

GATATTCATCAGCTGACCCAAGACAGACATGCAACCAACACAGCTCGGTT

TCTCAGATCTGTCATTCCTTTTTCATTTATAAAAATTCCCTTGGCGCGTA

ATTTTGTTTTATTTTACACCAATAGGGTGTCCATTATGTTTTATTGAGCA

CGCAAAGAGGACGTTGACAGTGACAGCTTGTGAACAGGACATTTAACGTT

AGCTCGCATGCTAGCGTGCTATGGGTGGAAACAGCTGGTAGGGATACTGT

ACATCTTTACCTGCAATGTAAACACAGGTTCACTATTTGCTGTACATCGT

CGTGTGAATATTTGATCATTTGCAATGGCATCTATTCTGGATCAATATGA

AGATTCGCAGAACATCCGTCAACACAGTCGTATGTCCACGGCCAACATCG

GCATCACTCATTCAGgtgcaaaccttacatagtttgctattattattgta

ttttaagtaatgtatggtgtttataatgatttaaactaaggcttgttttc

cacagGGTTTGTAAATGTAAGATTGGAGGAAGAAAAACCCATTTTCACCA

AGCAGCGCATCGATTTCTCTCCTCCCGAAAAAATCAACCAATTTTCGGTT

TGCAACAATCAGTTATGCATGAGCTTGGGAAAAGACACCCTGCTGAGgta

aaactgccatttctcgactcttatgttatctacagttgtttaattgcgat

gctttgcatttgataagttttcccttgattagttcacgtacatgcgatgt

gtgattaatgtgtattttggtgtctgaaaggctaaagcatgtggaccatt

aaagacagttcactttgaaatgtatatttaatctggatacaaatcactta

ttctttgtctttatttgtgttggtgtcaatctaattgtgattcatttgca

ttatatgtggtcctaaaagattcaaaagtcttgggttaatttttttaaac

tgactttaaagatgttggtcatttttatagagcagattcaagtgtgttgt

catgcatattgtgtttcagAATTGATCTCGGAAAACCTGATCAGCCAAAT

CAGATTGAATTGGGAAGAAAAGATGATAGCAAAGTACACAGACTTTTCCT

AGATCCTACAGgtaatcacgcatcaatattcacaacttgtatgaggtttt

aaatgcatttaggccatctattcaaagttagtaaagacataagtggtttg

attagattttccttgtaatttgtaagacaaaaaaagcatcgaaaagtgat

gaactggggaattaaatgaagaaaaaacttgaacagatgcacaagaatga

acagtcataaatgtaatgcttattgtttttagatggattttatttatgtc

atgtatagctcttcagggtatatcattcagagattctaattctttgttta

cacttagtattaagacccaactttgatgacatgatcaagtgaaatgcaaa

tgctgcattttccattatgtacaagattgtttttgccttacaaaaatatt

tgtaagttttgtctttttaaactgttatcttgtgctagtacaaatgattt

actaatatttgtttatgtagatcttcattaaaaaatgataataaaaatat

aatataatgaaatataataaaactgtataaaaaatcacatatatgtgtga

aattctacatttaaaatgaaattaagtttcaaaagttgtttttgttcaca

agctaaatctcgcttcagtgcagcagttaactttaagtggtcagtttggt

ctaaatgcttcagatttataagattattatttataagattatttataaga

ttatccttttaatacaaactgttcagttgtatacttttgccatgtacacc

atcatttaaatgtgtaatgttaattatgtaagttaaaaatacatactaca

tataaaagacttgaccaaataatccatctataaatatgataagtgttatg

tttatgattgtaaatttaaggtgatattatttaccaacaaaaaatctttt

ctctatagtagtagttgatgctcatgaaatggatggacaagcttaagtcc

gtccctgatacattttttataagtgaaaatgtacgtttagtagaatgtcc

catttaattgctcaaatgttgtcctagttgtagtgtcaatatacggtggc

ggctcttgctgcttcgacatctgttttgatcatctttaattaaagggata

gtttagccataccaccatttacattcaccagtccgcagggtcttaaaaaa

agtattaaaagttgataaaacaatgtaagaaaatgtagggcccttaaagt

attaaaaaaagtcttaaatgctgttttgtatggttgtattctaaagttta

tctgaattaaatccgagaatatcaggatgctgtatagtttatgaaatcaa

ctaaatcctgctagatttgacatcatgttgttttgtttactgcagtaacc

aagccagccctattattcctgcagttctataggcaccaacctgctgaatt

ggctagatttaatagacttttattcagtatatgactaatgctttactttt

ggattagtttcttactttattatttagtaaatatactgtaggttaaaatc

ttgccagtgtttccagttgaaaagtggctatagggtcttaaaatgtatga

aaagagtcttaaaaagttcttaaaaggtttagaatttccctctctgattc

ctgtaatctgttatcactgaccttcttaaacatacttatgttttaaaata

ttctgtaaatgatcttttctcaaatgttttacagGGTCACATTTAGTCAT

CTGCCTCACTACAAATGAATGTGTGTACCTAAATAGAAACACTCAGAAGG

TCCGAGGTCTGTCAAGGTGGAGAGGCCACTTGATTGAAAGCATAGGTTGG

AACAAATTAATCGGCTCTGAGACCAACACTGGCCCCATTCTGGTCGGGAC

CAGCCAGGGAATCATCTTTGAAGCTGAGATCTCTGCCTCAGAGGGCAGTC

TGTTCAACACCAACCCGGACCAGTACTTCAGACAGGTTCATTACCTCGAG

GAGGATGGCAAGCCAGCTCCGGTTTGTTGCCTGGAGGTTGAACGTGGTTT

GGAAACTAAATACTTTATCATTGCAACCACACGAAAACGGCTGTTCCAGT

TTGTAGGAAAGCTGGCAGAAGGATCTGAGCAGCAGGGCTTCAGCTCCATC

TTTGCCCAGAACCAGGATCTTCTACCCAGCTTCCAGGAATTTCCTGTCAA

TATGGGCTATAGTGAGATTACATTTTACACATCAAAGCTGCGTAGTCGCC

CCAAGACCTTCGCCTGGATGATGGGGAATGGCGTTTTGTACGGGCAACTG

GACTATGTGCGCCCCGACTCTTTACTCAGTGATGTTCAAGTGTGGGAATA

CACGCAAGACATTGATTTAAACTTCGTCAAACCCATCTCTATAGTCCTCA

CCCAGTTCCACTTCTTGCTCCTGCTCCCTGACCGTGTCCGAGGGATCTGC

ACCCTGAATGGGCAGGTTGTGCATGAAGATGTGTTTCCCGAAAAGTTCGG

TACACTACAAAAGATGATCAAAGATCCCATAACAGGACTTGTGTGGATCT

ACACTGAGAAAGCAGTGTTTCGATATCACATCCAGAAAGAAGCACGGGAC

GTTTGGCAGATGTACATGAACATGAATAAGTTTGATCTGGCCAAAGAGTA

CTGCAAAGATCGACCAGAATGCTTAGACATGGTTCTCGCAAAAGAGGCAG

AGCACTGCTTTCAAAACAAGCGCTACCTAGAGAGCGCCAAATGCTATGCG

CTTACTCAAAATTACTTTGAGGAGATTGCGCTGAAGTTCATTGAGGCCAA

GCAAGAGGAGGCCTTGAAAGAGTTTCTGATTAAAAAGCTGGTCAATCTCA

AGCCCAGTGAGAAGACTCAGATCACCCTGCTGGTGACCTGGTTGACCGAA

CTCTATCTGAATCGGCTCGGTCAACTGGAGGCCGACGAAGGCAAGCAACA

TTTATTTCTGGAGACCCGTGAAGAGTTTCGTACCTTTCTTAAAAGCCCCA

AACATAAAGATTGCTTCTACAACAATCGCAGCACCATCTACGACCTGCTC

GCTAGTCATGGCGACGTGGACAACATGGTGTATTTCTCGGTCATCATGCA

AGATTACGAGCGTGTCATTTCTCATTACTGCCAGCATGACGACTACAGCG

CAGCTTTAGATGTTCTCTCCAAACACTGTGACGACAAGCTCTTCTACAAG

TTCTCCCCAGTCCTCATGCAGCACATCCCCAAAAAGGTGGTCGATGCATG

GATTCAGATGGGAAACCGGTTGGATCCGAAGAATCTGATCCCAGCGCTTG

TGAACTACAGCCAGATGGGCAGCATGCAGCAGATAAATGAGACCATCCGG

TACATGGAGTTCTGTGTGTATGAGCTGGACGTCAAAGAAGAGGCCATTCA

CAATTACCTACTCTCGCTT

hi2499a (3-5)

TATGCCAAACACAAGCCAGACGCTCTGTTGTGGTACCTCGATCAAGCCGG

AACTCACGTCTCCGATATTCATTATGACTTGAAATATGCCTTGCGCCTTT

GCTCCGAACATGGATACCTGCAGGCCTGCGTCTTGGTTTACAAGATTATG

GAGCTGTATGAGGAAGCTGTGGATCTTGCTCTAAAAgtatgttcgctttg

acatttttgacacatttattatgttttatattttaaacccagagtacgct

ttgttgtttaacatgcaaaacattcttcaacatctgcttctatagggtat

gtgcagagctagtgtttcttcccatactgatcagattctggtaaaacgtt

aatgtgacttttctaaattttatacggttccttttacagcatcgatgttg

taaagtatttaaaatataatcagttaaatagactttagcattcatttagt

tgttcaagcataaaacaagattaaaagccgtcagggttagcaggctagcg

cagaaacttcattaaatatacggggtaaaataaatgttcctattttaaag

acatgacatgaaaaaatgtaattgaatgcacccactttctatcgtattgt

aaatcaatcagacggtgaagatcattgatttttcaagaaaacagacatta

aacatgtcaattttgtaactgcatactgttcaccagaagcgcttgatcca

ggctactgaaaatacttaaaagtccttccgcagacctatgcatataccct

tgtggttttgccttctccggtgctttgttgttgttcttgttctgtttttg

actgtaaaaaacaatggccttgtccgatgttgccaccatgtggacagaca

atgtagtataaaatacaattcaaaactactgttttgtattgtctaatact

tgtatgtatatatgtcaaataacatggcaccagcaaaaaaaatgtaatgc

caaaatatttttttattctttttttattattaagtttgtacaattaaata

caaatgtaaatatatttttaaatgtaacataataataataataatacata

cacacttcaaaatatatatttaaaataaaaagaaaatgtacatatttctt

atggttattcctcaaaacactttgagtaattcaattaaaacaattcttta

aaatattaaaaaaatatgtctgaaatcctagattatatttctgaaagatt

tctgtatatgttgaatataaaaaaagtatcatgaacttccttacgagtta

caagctaggaatcatttacagttagcatgactaatttctttgcagaatag

aatgtaaccaatattttaactatcaatatttggtgaaattaccccaattt

tcaatcacaaatgaagacatgaatcctgtaatataatttcattcatttat

tcattttcgttttggtttagtacctttatttatctggagtcgccacagcg

gaatgaactgccaacttatccagcataattttatgcagcggatgcccttc

cagctgcaacccatcactgggaaacacccatacactcccattcacacaca

tacactaaggacaattttgctcacctatttcacctatagcacatgtcttt

ggactgtgggggaaaccaaagcacccggaagaacgaacacagggagaaca

tgcaaactccacacagaaatgccaactgaggctcgaactagcaaccttct

tgccaccgtgacgccataacataatttgtaatatatttgtctgtgtatat

gactttgttatggtggccacaatattttcaaatataaaataaaacctttg

cttttccgttcagGTGGATGTGGATTTGGCCAAGTCTTGCGCCGACCTTC

CAGAGGACGATGAGGAGTTAAGAAAGAAGCTGTGGCTGAAGATCGCTCGC

CATGTAGTGCAGGAGGAGAAGGATGTCAAGAAGGCTATGAACTGCCTGTC

CAGTTGCAACCTGCTTAAGATCGAAGACATCTTGCCTTTCTTTCCAGACT

TTGTCACAATAGACCACTTCAAGGAGGCGATATGCAGCTCTTTGGAAGAG

TACAACAAACACATCGAAGAGCTGAAACAAGAAATGGAGGAGGCCACAGA

AAGTGCCAAACGCATCCGCGAAGACATCCAAGAGATGAGGAACAAGTATG

GTGTGGTTGAGTCTCAGGAAAAATGCGCTACTTGTGATTTCCCCCTGCTC

AACCGACCTTTCTATCTTTTCCTGTGCGGACACATGTTCCATTATGATTG

CCTCCTGCAGGAAGTCATTCCTCACCTCTCTGTCTATAAGCAGAATAAAT

TGGATGAGCTACAGAAGAAACTGGCAGCGACCACGCAGACCACCAAGGCT

CGGCACAAGCCTAGAGAGGAGGACACGGTCAGCTTAGGCAAAGGCCAGGG

AAGCAGGGAGCAGATCAAATCAGACATTGATGATATTATAGCGTGCGAGT

GCGTGTACTGCGGTGAGCTGATGATCAAGTCCATTGACAAGCCGTTCATA

GATCCGCAGAAGTTTGATCAAGAGATGTCCAGCTGGCTCTGAAGGAGAGA

CGCATCTGCTTGAGCTGCACAACACATTTATTATACACATTGTACATTTG

CTTAACATGTAACCGGATGTGCATTGTAAAATTTTTACATTCTCGATTAA

TGAACATTTATATGATTTTGTCAACAAATATGCACTGTACAAGTGTTCTT

CGTTGATTTTATGTGTTTGCTTCCTTAGATCAAATTTAAAAATGCACTTG

TTTTCATTTTGCATAAAAGTAATGCGAATAATATCTTTTTTATGTGCACA

GCTAAGAAGAATAAATGATTGCCTTTTGACTGGAttttgtgttatgttat

tatttaatgggatttgaaagggtaagctagtttctattacttctactcat

agtacagagatagaattggtgtcccagtacaaat