RAD21 homolog

cDNA: Genbank BC045311

 

hi2529 is in the 1st intron, before the ATG

 

caacctccagcctcccttgcagccgcttcctgtcaatcagctaccaagct

cctcccaccgccaaattttgactgtaaacatcccgccgagagcgcgcgcc

ATCTTTGTCGGATTCAATGAGAGGAAACGGTTGCTAACTTCTCTCCGTAG

GAGGGGAGAGAAAAGACTGATCACGAACAACACGGATAAGATATTTTGAA

TGgtacgtcccaaaaaattcgtgtttttgtggataaatgagattaagaag

gggaatgtgcgagcagggggatgaaatttgacgctcgcgctgcttacgtg

ctgcggctaatcaacagttggctaaggctaattgctaacgatagcttacg

aattatttggctctgaaagcgttatta

hi2529 (3-5)

aaatgactgaattaccaatttatggcgtttaaaagatcaacgcgagtgag

ataaaattaagttacatcgtttacactctatatgttctagaaattatttt

tttaaaagcgaaatagcgtcgcttgcttatcagctgcttagccaaacgct

agtgtggacacaaacgcaacagttctgcatgtttaaatcgagctgcttgt

ttatacgtttgcatgtttagttttcttatcttgtttttataaaatttaga

acaattgttttggataatgcacttcattaagggcgtaaaagtgtggttta

gctcattttcttcatgttataatgctggtgtgaaggcgggcaattcttca

aaataaaccaactaacgtaacgttagcatctcggctagctttaagaagta

gctttgtcttttataagataattttgtatttaataggcttatgattgatt

gttttgtgttagatgtggtacgaatgccctttattgtgcagttctatggt

cttgcctaaatgcacgtgcactttattgccatattgtgtatatatatctg

cattttgtagattgatctgcattagatcttatgcatgctgttttgttgtc

ttgtataaaaatgcatgtgcttgtagatgtatagggtttagatatggtca

gttgcattttatctcttctcataatttgctgacttatccatcatatgcat

cttctagtctaatggatctggtgtccgcggggtcttaattttcaaaaact

aaattatagacttttaaatagtctttaatttgcgtaattactgtgttgta

ggtctttgataatttttaataagtctaaatttacctatgtccttgtaaag

ttaccctatcaggaaaagacccaaccaatcaccagcaatacatctcaata

aaactttttacaaaaagattttttaacactatctagcacgtgcactttat

tggcatattgtagattgatctgcattagatatggtgtacgttatgcagtt

ttgttatatatatgttgtcttttaatttaataacttatccatcacaggca

tcttcaagtctaatggattttatacatcactgtagtctgaaaagggtgtc

tgcggggtcttacatttcaaaaactaaattttgggcctttataaagtctt

aaatttgataaagtattgtgttctaggccggtataagtttgtgatggtat

aattaccttggataaaaataccatggtttaacgttattgtgactattgct

ctaaaattagttgttttttaatgtctgggtaaaaaacaacacattttccc

cattgaacacagtatacagtattttatttcacaatttgctattcacattt

ataacattttggagcagtaaacatgtcaggctaataattaaaagaaatca

ttaacttctacggtcttcattagtttataaaacagatatttctttacaac

actttaaaaaacctttacatataccttaagaacggtgtaacaaagttttc

gcagtttttaaaatcttgacttttccaaatcgcggtaaacattaaaaccg

gttatcgtcatgcttagatgtaggtctaaaataattttgaataggtctta

attttcccatgtccatgtaaagttacccaatcgggcaaggaccaatccaa

tcaccatcaatacgtctcaataaaacttataacaaaaaattatttattaa

ctctatttaccaatatggttttattaccttccctagaatacattttattt

ttaaatgtaacttaatccttttacaaagattgctaaccattaagcccttt

tgtgagtctgaaattgtatttataatggtcttaaaaagtcttaaatttgt

cttaaatccttgctggagttttaaataattctgttttcttccagGTGTAG

TGGAGAGATCTCAGATCTTTGACCAGACACCGGGGCAATGTTTTACGCCC

ACTTCGTCCTCAGTAAACGTGGGCCGCTAGCCAAAATCTGGCTGGCGGCC

CATTGGGACAAAAAGCTGACCAAAGCGCACGTCTTTGAATGCAATCTAGA

GAGCAGCGTGGAAAGCATCATTTCCCCAAAGgtgagtgtttaacactggt

tgttgcatgatgttgtgtgtaggcatgggtcagtatacaattctgatgct

atgataatcttggataaaatataacagattcactgtatcgtgattactgc

tctaaaatatattttaagtgtctgtgtaaaaaaaaccattttggagcgat

aaacatgtcagactaaataatgaaaataaataatggacttctgcaggctt

ctttacaatttaaaatgacatttttggatatcttttttgctgtagatgct

gttgtacttaaaaaaaaaatcttacatacaccttaggaatggtatagcag

gaaagtttgaccgctttaaaaaccttgacttttctaaaatgcagtgtacc

cgtgtctagttgtgtgtgtgtttgtggacgttaaatctcttttaatactc

gactgtatagGTGAAAATGGCTCTGCGTACATCTGGTCATCTTCTCCTGG

GCGTGGTGAGGATCTACCACAGAAAAGCCAAATATCTTCTGGCTGATTGT

AATGAGGCATTTATCAAGATCAAAATGGCTTTCCGCCCAGgtattgtatc

aaaacatgagttacaataatttgtttttattatcgtctagctttgcctgc

ttgtatttactagtttgggtcggttttagGTGTCGTTGATCTGCCAGAAG

ACAACCGTGAGGCAGCATACAATGCCATCACCTTGCCAGAGGAGTTCCAC

GATTTTGACCAGCCTCTTCCTGATCTTGAgtaagtcatgcatgttgtttt

atgttttaggtgcaagttttggtctgctttaggatgtgggaacgtattaa

atgtttgcacggcaaatttgattagtcttcagtggtccttgatttggttt

tcatgtatatttatgcacaaatgacttcttctgaatgtgatttttgattc

taacatttgtatttcagTGATATTGATGTAGCACAGCAGTTCACCCTGAA

TCAAAGTCGTGTTGAAGAGATCACCATGAGGGAGGAAGTAGGAAACATCA

GCCTCATGACTGACAACGACTTTGgtaaaacctgaaagaagcatttcatt

t