laminin, gamma 1

cDNA: Genbank NM_173277

 

hi2557 is in the 1st exon

hi1193, hi3890 and hi4131 are all in the 1st intron (which is ~59 kb)

 

GCATCCTTCAGGCGGAAGTAGACGTAGGGATTTTTTTTTGGAAGTGCATT

GACTTGCGCACTAGCTGCCAGGGTGTAGTCGGATATAGTTGCTTTTCTCC

AAAACTTTTTTTCTCCATGGCGCTGGTTACAAAGCACGAATAAAGTGAAG

GTTTGTAGGAGAGAAGTCGCGAGGAGGTTTAAAGCCCGCAACTATAATCA

CTTTTCCGGAGGTGAAGCGACTACCACCATTTTCCGCATGAGTTTATTTA

TAAAGCCACAAACTCGGTAGCTGGCGAGTTACCGCAAACTTTTTTTTGAA

AGACTGCGAGGATTTAAGGGATCAAGACAGTGACGGTAGCAACTCGAGGT

CGCAATAGCAAAAGGACACAATGTCGCTTTTTAGCTGTTTGTTG

hi2557 (5-3)

TTATGGACTTTGTGGGCAGCGTGCAGTCACGGAGCGATGGATGAATGTAT

AGACGAGGATGATCGGCCTCAGCGCTGCATGCCGGAGTTCGTTAACGCGG

CTTTCAATGCGACCGTGGTGGCCACCAACACTTGCGGCTCGCCGCCTGAA

GAGTTCTGCGTACAGACCGGGGTTACGGGAGTCACTAAATCATGCCACAT

TTGCAATGCCGCGGACCCCAGACTGCACCACGGCGCTGTTTATCTCACCG

ATTACAACCAACCAGTGCAACCAACCTGGTGGCAAAGCCAGACTATGTTA

GCGGGCATCCAGTACCCGAACTCCATCAACCTGACCCTTCACCTGGgtaa

gcagctctcatcaactttgccttcatgaaaatggctcgaagttacaaaat

gtttcttttcctgcactgcgaagaaaagttgttcttactgtcaactttgt

taatttaatactactgtaagtgggctaatacactaatgtcttagtttaat

tcgtagttcattagttattattagtcactactgtacagatgtagccaagt

atgtattaattgcagacttattacacagatatactcctttcctagcttac

agttgggtgtttctagtgactgttggtaca

 

approx 19 kb into this intron

 

tgtgttgaataattggccagaatgctagtttgcatgggtggtgttggtag

taaaggctacaaactctttaggggtgttcgtgg

hi3890 (3-5)

aggaccactttcctgcagtttagtctgtccgaaataacatgcttcctagt

atgtgcacacagtaaatgatcaaggtagtaagtctaaattaatagtattc

aaaaaacagatttatctagatgacatttgttatctgtgcacccactttat

ttccatccatgaattttctgatatggccatattgacagtaaagcgacaca

acagaatgtgctgatggtgatgggttatgtgatttagaccctgtctacac

taatttgttttagttttaaatcacgcaggttttgctatggttaagccttc

tgtccacactactccagagttgttgagggctgaaaatcgagcatattgga

aatgcttaaaaggctgttttcagtttaaaacgctgctgctccatctcagt

gtggatggggcgaaaatggagacatctaaaaacggaggtgtggatgcaga

cattcatctgattggggctttttctcaatgttaagtagcctacacacagt

tcagtcttgcatccttttttccttttaagttcagacttcacaagtttgat

atgaaaaacaaattctcgaggacacatcgggtgaatcttgaaagggaata

gtggctttataacgtcatttgcatcaccctggctacgttgtttcacttta

ttaacatcatcactgtatgcatttatatcaaaatggagcctataacataa

ctgcctcctttaattttttagtgaaaaatacgaaacataccttgtctctt

atgctaaatatcagttttaataatcaataatggacatcataaaagtataa

cgtacaacaagtttatgcgttataggaaataaaggcaagcagtctgttaa

tatgcagaatctgtgtatacgcagttacttaaattaatatattggcctaa

cttatctttgcgttcagccaaaatgcgttacctgagaagtaaaagattta

atagacctaagtcggggaatatgccgttagatatagacaagattatttat

gtatctcatttaacaaatatagtgagattagatct

 

approx 24 kb further into this intron

 

ctcgtccctgacaatgtattgtactgcattcctcagattcctctattgta

atgcaatgcatgcctccctccttcacttcacctacccactgtaaaatcac

tagtgcacaatggttgttgagggctgattggtttctttcttcttcaccag

gctctcactgttttgtccagatctgtcatagtaactgttgagtatgagtc

acagaaaagggagggttctgtgttgcttgggttacaggttaaattgagct

tgactgttttggaaagccatgtttttacgtgactaagcggtcaaaggtct

ttcttgagacttggaagttacttatcattcactggataattagaaaatta

agcaatgaatg

hi1193 (3-5)

ttagctcaacaagagttctcaaaacaatatggctggttaaccacatttcc

aactagatatttaagaagacaacaggtcccactggaggttctaataagtt

gtttcggaaaccagttgtgaggactaaaggcagctgttcactttcattgc

cagaaaaggaggactgaaagactgtaaaaatggtgaacattgtttcttct

ttttgtttggttcatgtgtagggtggaacaattgaaaagttggcgaatgg

cacaatcattttgttttcctcaacctgatcaatcccagctgtcctagaat

 

approx 10 kb further into this intron

 

catatagtttaaaacgctgtcatatggtgtgcaaacagcctcaaccttat

caaagactgtagaatacatatgacatgtcactctttcaatggtcaatatg

gatgcttgagagaaggaagccccgtcttttactaaatgagccgatcattt

atcgctatcgattgatcattctctggaggagaggctcggtccagacatgt

gtttatgatagtttgtgcagctttgttgttatggaccctctagggttgga

aaacgtgctaaaagcctctcaaacgtgagaaatctatcttcacaaagcct

aaaaaatatacttttaaatgaaccaaccacactcttttgttttgtaatct

gtatgaaacaaatacaagaacaaacaggtttgatggaaatgtttgcacgt

cacatgatgacaaccatttgaacacctacaaa

hi4131 (3-5)

tgtgaaacccaagacgttactatttttggagatttttctgtcaggaatac

ggtgtaaattttatcagaaaactaactcaattggacgcagcactatttag

aggaaagttcgtacatagtattattaacagaatgacgtatgagtagggtt

aacgcaatactgaaaattgtataattggtactgaaaatttaaaaacgtcc

gtttcccatgaacatttaaacgctgtagagcacgttcttaaatggtgcta

atttgccattgtgttctcgtgctcaacagaaataactgtgattggctgtg

taggtcatcagttcaccaaactcaacgctgtttactgagtgtaaacacag

atacagggagact