myeloblastosis oncogene-like 2 (b-myb)

cDNA: Genbank AY648782

 

hi2561 is in the 1st intron

 

ctttacgtcactcgcgggaatggacgagaaaaagaagcgcGAGATAGAAA

CTTGGGCGCGCAGCAGTGGATGTTTAGCTGCGAGCTCCTGTGCGCTTTTC

AATGAAACTCTTTAGTTAATTTGATCGACTGTCTAATTAGCATCACACAT

GAGTTTATGCGTGTGTTCTAGACTCAGAGTGTCCTCATAAAGGTCTGTAT

TATTGGCGTATTTTGATCAAACATCAGGGAAATGTCTTGGTGGGCGCGCG

Ggtaagtacactaagtttattattcgtacatgtttattgttcatctgtaa

tggagattcactttagggctagaaatgagacttagaaatgtattctgcct

gtgcatgtggtgattgttgacaataagtttgtgaatgatccattgaaccc

cgcctaatagcacaaagagagctgataaacgcggaactac

hi2561 (3-5)

tataatattagcataataaagatttgcacaaagtcagatttacaatgtta

gtcagcatcacacactgttataagttgtacatttagctttaagaccgaga

aaagtgctttatactttgatgacaagcgttgttaatgttagctgagctgc

taatagctcgagatattagctctgaatgtgtattgtattttaatttaatt

attgagcacatttaggggggttaaagtattattttctgaacttttttttg

cagtaaaagtgtttttttttcctttggtgttaatagacattgtttagcaa

acacaaggccctgataaatggtgtcaaacagtgtttgctgatctgcggtc

agtgttgtttaacgtgtatgtgtgtgtgtgtgttacagTGAGGATGAGGA

GGAGGCCTTATGCCAGGACACAGACTCTGATGTAGCTGACCAGAGAGATT

GTGGGAAGGTGAAAGTCAAGTGGACACAAGAGGAGgtaaacacatttctc

taattgcagaatctaaacaatattggggtgaagttatttttgaggtttta

tattcacacattcgtatagaggtaaagttggtttaatattcggattttct

gacgttctccttaataatatcatttcagaaaagtgttctttgcaaattat

aaataggaaaatcatattagcagccaatgcttatcatagtttacagtcag

ttaaatagtgctaatgttgttttgaactcatacttgcatgctaattctga

tagaatatttaaaaaaaaagcgtagtaaacaatatagagacagttaaatt

aacgaatgtgcgattataaaaccaactttacctcaattactttcctttag

tgatagcttgtgacatgcttcctataagttcccatgg