NMD3 homolog

cDNA: Genbank BC090467

 

hi2570 is in the 5' UTR

 

ctgcagctttaaatcacccatttgaacctaattaccctgtatttaccgag

ccatcttgtcaaaaccagactattatccttgctcatgctttactggggtt

taaaattagaaagattttcactcagttccctcggagaataaccatttgtt

tgtttgttttttctcatttacattcaggcgcagttcggacagctatcggg

tgttgttatttgtttatttatattgttttaaagaattcacaaataacaaa

tacagaaaaaacagacaaaacaaaaactgcaaagatgatataaaaaacaa

aagaaaaatataagaaaaacgaaacggaagacggtcagctgcaagggtct

tttttgacaacgtGTCGTGACGTCATCAACAGGCGCACACACACACGTGC

GGAGTTCGTGTGATTTTCGCGAGGAGATGTTCATT

hi2570 (5-3)

TAGTTGAGTCGATCAACGCTGATTTAACAACACAgtgagtatcgatccag

tgtttgtgtgtataatagtatagtaataacaatactggcgaagatatcga

gagcgttatagtcttctcacaaccatacttcacacgtaattacacccata

catacatacaaagagtgatctgtaagttagcaatggtgtatgtgtttatc

tgtcagtggatacattattttaagtttatgacagtggtgaccagttctgt

tagactgattatgctttatattgttaatgtcatgaatatggagtgaagtt

ggttttatattcgcactcttagacgttctttctaataatatagcgttaat

ttcagaaaagcatacttgcaaattctaataaatgggaaaatcagcagcga

atgactattaaaggacaacactgttgacagtcagtaaataatgctaatgt

tgttttgaagcgcttacatgcgatttcagacccaatattataagtttatc

ctgataaacaatgtagggagcgttaaaaggaaacaaatgtgcgaatataa

aacaaactcaatatattatgagtgtgattaatgatgtttggggtctgtgt

tgttgctgttgtagTCATGGAGTACATGCAGGCTCCGCCATCCAGCAGCC

ACGGCAATATgtgagtattcaacttttataagtactgtgttgttatatta

atattagtatttactctccctcaagtggtcgcagatgtttatgagtttct

tttatttctgccgaaccaaaaataaacttgaattattaatcaacagcatc

agttgagatttggctcctacatattgctttttttttaatgtaaggcattt

ttcagtcattcattttccttcggtgtagtctctgatttatcaggggccgc

cacagcagaatgaaccgttaactattctagcatatgttttaaacagcgca

tgcccttccagctgcaacccagtactgggaaacactcatacacactcaca

ctttgctatctggactgtgcccaggcccgtttcccggatcatttgagaag

tgcgtgtgcgctgaattgggctcaggcacatttcagttggccggccctag

cggttcacttgggcagttcacttgggctaagcgcgcctgagcccgtaact

gaagacgagacgtgacttttaagggactgtttcatattgatttattaatc

attattaatgttcaataaacacaaaccatcgtagattattaaagacacaa

acccctcactgcacgacagctgcaccttcagcaaacctcctaaatcctgc

agcacgaggcaataatctcagctacacagaaattgggaaaaaaataaacg

ggggcgaataattcagggggctaataattctgaattcaactgtacatatt

gtcattattattatttatatattttagcttgtgtattatttattgctgaa

tttaaattgttatgatattgttataactatagaaattgtgtttattttat

tgttataaatatagtggtatttataaaatgtggtaaacttgatctgtttt

tgtttttgccatgacatagctaaagaagctgaaaccgcattaatctcgaa

attctctctccctcattgtcttactgtatttctgtttatctgtatgcttt

tttcagTCTTTGCTGTACGTGTGGCGTTCCCATTCCTCCAAACCCAGCCA

ACATGTGTGTCTCCTGCTTGAGGACTCAGGTGGACATCTCTGAGGGCATC

CCCAAACAAGTGACCATCCATTTCTGCAGGCAGTGTGAACGgtacgctct

gtttctgttagccatgggccggtgtacgattctgacgatacaataacctt

ggataaaatgatcacggtttcacggtattgtgattactgctctaa