TWIST neighbor

cDNA: Genbank AY648783

 

hi2573a is in the 1st intron

 

gttattacgatataatagagtggggaaaataatgtgtgaggggcagcgtc

acagcaactaaaaaaaatgtattattatatttatgcagtgtgtgtagttc

tcctcctcaccgctggcagtcgcgcgtctctccgcgttcaaacacacgag

caaacacaccacgtgctcctccacatgtgtacagcATGGCGAACTGGACT

CAGGAGGACGGAGCTCCGACACCCGTCACAAATCCTTCTGAAGTGTCGCA

GGTCTCCGGCGGGAGTGTCACCGGCGGCCCCGCGGTGACTTCGTGCCTCA

TTCCGTCATTCGCGGAAGCTGTGAAGTTGCTGAAGGCCCGATACTCATGT

CTGGTTCTGGACACTCACCGGAGACACATCTCCCTGCCGCCAGTACACCT

GAAGAAGAAGAAAACCGGCATACAGGAGCAACTCAACGCAGAGCTGCTGA

AATACTCTAACAGgtgcagcataaacacattactagaaagtatctctatt

aatgacgttaacgctttgtttacatgcgcggctccaagagctgatgcacg

gttctggtgtcataagagtgatttgtatatacatggacagcatatttaaa

gggacagttcaccccaaaattaaactctgtcataatttatttatacttct

ttctcatactttttttcattaaggtaaaacttgggtttatat

hi2573a (3-5)

tggtaaatcagttcatttttaacgacttatgacaggcccgtagccagggg

gcgtttgggtggttcgacagaactaccccccaccccccaccccactgaca

aaggtccggaatttgccattgctccaaaatgtttgccactatattctcaa

ttgatctacgttgactgctatatcatcataatttgtgggaataacccatc

aaaggtgttaagaaaacgcacaatacgacgcacaatgaaatggtcagaag

cacgaaagcatcttattaaagttaattttaatactaattaggctgtgcat

aaaaatctaaaatcaaaaagtgttcacaggggaagcttaaataatgtgtc

ggttctctttatgtaagggattcaggattctgcctagttatctaattacc

ctagttaagcctttaaatgtcactttaagctgtatagaagtgtcttgaag

aatatctagtcaaatattattgactgtcatcatgacaaagatcaaataaa

tcagttattagatatgagttattaaaactattatgattagtaatgtgtta

aataaaatctgctctcagttaaacagaaatgggagaaataaacaaggggg

gctaataattctgacttcaactgtatacacttgtttttggcccacctgga

atgtcacttgacccaccctaaagcttgagccgggcctggctgtgcagctt

taatttaggcttttaaaattggggtgaattgactgtcaacggagagagaa

tttgtccgtttttttgctataaaccttcagttaacatctattattatgaa

taatgtgaaattattcactttttaagctaaactaaacccataataatcct

tctgagtaaagaaatctccatttgttctctggttttgcagTCTGGATGGT

GTTCCTGTGGCGTATGACAACATTAAAGTCGTGGGACAGCATGGCAATAT

ATATGACGATCAGGGATTTATTCACTTCAACATCGAGGCGTCTTTCGTGA

TCTTCAGACCAAAGAATGGATCAAGGCTGATGgtatgttttttttatctt

ctttgcattttgttgcaaaaaccagtaaacagaatattt