nucleolar protein family A, member 3 (nop10)

cDNA: Genbank NM_001003868            

 

hi2578 is in the 1st intron

 

ctcctccaacacacctgaggcagtcgctcaatgcagaatgctgaatttga

actgcacgctttcaaaaacaaacaaaaacaaaccaattaatactgctata

ttcacaacactgactgattatatgggttattatctattacatattataat

caactgaaataagtgcttgtttttatggttttattaatgtaaatattaat

attttattatgttctacactaggtggcgcgctctctcctacgcgtgattt

ttgaaaactccatttcccatcctgccttgcgtcccgctccgcACATCCGC

TTTGCTCTCGGTCAGTTGCACACGTGTTGCCTTGCACCGCAGCAGCCCTC

TGATCGTAAAAGCTGTTTTCTCTTCAGAAATCGTCGAAATCAATCCGTGA

GAGTTCGTCATGTTCCTGCAGTTTTACCTCAATGAGAATGGCGAGAGGGT

TTACACTCTGAAGgtgaggatttgttgtttaatctcggcgttttggctaa

aaacacgcgtcatagagcaatgatggttatttaatctggtcatataactt

agtagatgcattgattgttactgtaattgaggt

hi2578 (3-5)

aaagttggatttatattcgcatattctgcatatagccccgtgttgttttc

cacactttgaatattgagtctgtaaacaacatgagcaccatctattagac

tgtaaacagggctgtactttgataatctttggctgataatatgatttaac

tattatataattcgctaataatacttttccgaaggtatatttttaaagag

aaagtctgaatgtgcgaatataaatgcaagtttacctcattgttactgta

taacttagcgttactatagtaaaagaaaacactgtggtgtagcatactga

agttcagtgtatgtcactgcatgtattgcagtattggtttacaacacttt

aacaagtgctaaagaatactgtagtattagctgtagataaactaaaaaat

actgtagtacaatttagtttttactacagtaaactgtgctgtattgtggt

ataatataccttataattgtagaaaagtaaagtgtttggtgatttgttaa

tattactaaagttgctgtgttattctagtcattgttgaaacactaaaaca

gattgaagtactttactattgtgtttttcaaaaacagtttagtattttct

attaatcgctattttaatgtggaagtgctcattatcatcattgcgtgagt

tatatgtaattttcttattcaaagaaaaataatgttaaatgttcaaatag

atct

 

unsure how far to next exon